Ground poultry meat from above treatment was prepared by addition of sterile phosphate buffered saline (PBS) to make a 10% (v/v) suspension, which was mixed thoroughly by vortex at the maximum speed for 3 min (Fisher Vortex Genie 2, Fisher Scientific, Bohemia, NY, US) at 25 °C. After 10 min on ice, the supernatants were further diluted with PBS to have a final 1% (v/v) concentration [25 (link), 26 (link)] that were then dispensed in 150 μl volumes per well into 96-well EcoPlates™ (Biolog Inc.). The plates with lids were incubated in an OmniLog System (Biolog Inc., Hayward, CA, USA) at 25 °C for 168 h. This typical 96-well microplate consists of 31 unique chemicals and a water control in triplicates. The tetrazolium dye in each well was converted into insoluble violet formazan after bacterial respiration. The concentration of the formazan was proportional to the degree of respiration by the microorganisms in the communities.
Fisher vortex genie 2
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Fisher Vortex Genie 2 is a versatile laboratory mixer designed to agitate samples in test tubes, microcentrifuge tubes, and other small containers. It provides consistent and reliable vortexing action to ensure thorough mixing of liquids, suspensions, and other materials.
Automatically generated - may contain errors
4 protocols using fisher vortex genie 2
1
Microbial Community Respiration Profiling
2
Fecal Calprotectin Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fecal samples were processed according to the kit manufacturers’ instructions, with minor changes as described below (Bühlmann Calprotectin ELISA EK-CAL, Bühlmann Laboratories AG, Switzerland). For each sample, between 50 and 100 mg of feces were weighed into a sterile polypropylene tube (15 mL, VWR Scientific Products, Suwanee, GA, USA). Extraction buffer was added, adjusting the reaction volume to each sample weight to obtain a final 1:10 ratio. Extraction tubes were individually vortexed for 30 s (Fisher Vortex Genie 2, Fisher Scientific, Pittsburgh, PA, USA) at maximum speed and incubated for 30 min at room temperature on a shaker at 400 rpm (G-25 Incubator Shaker, New Brunswick Scientific Co., Inc., Edison, NJ, USA). Samples were vortexed again for 30 s, a 1.5 mL aliquot was transferred to a 2 mL sterile microfuge tube and centrifuged at 3000 g for 5 min. Finally, the supernatant was transferred to a 1.5 mL microfuge tube and stored at -20 °C until analysed.
3
Plasmid Isolation from Yeast Cultures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sterile PP 2.2-mL deep well plates with conical bottoms (M1810S; PHENIX Research Products) were thawed at RT. The complete 1.5 mL contained in the well was transferred to a 2-mL Eppendorf Safe-Lock Tubes (0030 120.094; Eppendorf). Plasmid isolation was performed according to the standard protocol for liquid culture of the Zymoprep Yeast Plasmid Miniprep II kit (D2004; Zymo Research) with two important changes. First, the centrifugation of the culture was performed for 3 min at 13,200 rpm in a Eppendorf Centrifuge 5415D (022621408; Eppendorf) and second, instead of the Zylomylase incubation at 37° the cell pellet was resuspended in Solution 1 was bead beaten for 10 min using 50 µL of 0.6-mm acid-washed glass beads (G8772-10G; Sigma-Aldrich) on a Fisher Vortex Genie 2 (12-812; Fisher Scientific). The ORF region of the isolated plasmid was sequenced using the standard MoBY-ORF primers for the 5′ (ACGTTCAGACGTATCAGTACATCACGAGACTACTA) and 3′ (ATGTTACTTACCACATCACGATAGGTCTCACGATC) position.
4
Enterococcus faecalis Contamination in Root Canals
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A suspension of E. faecalis (ATCC 29212) in tryptic soy broth (TSB; Difco, Le Pont-de-Claix, RA, France) was prepared and standardized to 4 on the McFarland scale. Forty-eight root canals were contaminated with the E. faecalis suspension by an insulin syringe. The plates were shaked (Fisher Vortex Genie 2; Fisher scientific, Bohemia, NY, USA) during 5 min to remove air pockets and to promote better bacterial penetration into dentinal tubules. The 8 remaining uncontaminated root canals were filled with TSB. The specimens were incubated at 37 °C for 21 days. The root canal contents were replaced with fresh TSB every 48 h.
After the incubation period, the root canals were filled with distilled water. Initial samples (S1) were collected using three sterilized size 15 paper points (Dentsply Maillefer), which were inserted into the root canals up to working length for 1 minute each. The points were stored in tubes containing 500 µL of peptone water followed by agitation in vortex for 1 minute, then, 6-fold serial dilutions were prepared. Different dilutions were plated in triplicate on m-Enteroccocus agar culture medium (Difco). The plates were incubated at 37 °C for 48 h, and the bacterial count was measured (in CFU mL-1).
After the incubation period, the root canals were filled with distilled water. Initial samples (S1) were collected using three sterilized size 15 paper points (Dentsply Maillefer), which were inserted into the root canals up to working length for 1 minute each. The points were stored in tubes containing 500 µL of peptone water followed by agitation in vortex for 1 minute, then, 6-fold serial dilutions were prepared. Different dilutions were plated in triplicate on m-Enteroccocus agar culture medium (Difco). The plates were incubated at 37 °C for 48 h, and the bacterial count was measured (in CFU mL-1).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!