Confluent mock MDCK, BI-1-overexpressing MDCK, and BI-1∆C-overexpressing MDCK cells grown in 6-well plates were infected with influenza A/PR/8/34 virus at 100 TCID50. The cells were scraped off 24 h after infection, and cell pellets were collected by centrifugation (1500× g for 5 min). Cell pellets were washed two times with PBS, and total cellular and viral RNAs were isolated using Easy Blue total RNA extraction kits (Intron Biotechnology). First-strand cDNA was synthesized from 3 µg of total RNA. PCR reactions were performed using primers for HA, (F): 5’-GAAAGCTCATGGCCCAACCA-3’ and (R): 5’-TCCCAGGGGTGTTTGACACT-3’; NA, (F): 5’-TGCTTGGTCAGCAAGTGCAT-3’ and (R): 5’-GGTTGTCACCGAAAACCCCA-3’; NP, (F): 5’-TGCTTCAAAACAGCCAAGTG-3’ and (R): 5’-GCCCAGTACCTGCTTCTCAG-3’; and HO-1, (F): 5’-ACATCTATGTGGCCCTGGAG-3’ and (R): 5’-CCTGCAACTCCTCAAAGAGC-3’. The amplification conditions were as follows: 95 °C for 10 min, 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min, 72 °C, 4 °C (30 cycles). The expression of the cellular housekeeping gene GADPH was used as a control to determine the amount of RNA in the assay.
Easy blue total rna extraction kit
Manufactured by iNtRON Biotechnology
Sourced in Cameroon, United States
The Easy-BLUE Total RNA Extraction Kit is a laboratory product designed for the extraction and isolation of total RNA from various biological samples. It utilizes a guanidinium thiocyanate-based method to effectively lyse cells and denature RNases, allowing for the recovery of high-quality, intact RNA.
Automatically generated - may contain errors
Lab products found in correlation
Ampigene qpcr green mix hi rox with sybr green dye, by Enzo Life Sciences (13 mentions)
M mulv reverse transcriptase, by New England Biolabs (8 mentions)
Labopass m mulv reverse transcriptase, by Cosmogenetech (8 mentions)
Iscript cdna synthesis kit, by Bio-Rad (5 mentions)
M mlv reverse transcriptase, by Promega (4 mentions)
Sensifast sybr no rox kit, by Meridian Bioscience (4 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (4 mentions)
Reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Image quant tl analysis software, by Cytiva (3 mentions)
Maxime rt premix kit, by iNtRON Biotechnology (3 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Quantitect reverse transcription kit, by Qiagen (3 mentions)
M mlv reverse transcriptase, by Bioneer (3 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (3 mentions)
Ethanol, by Merck Group (3 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Power sybr green master mixture, by Thermo Fisher Scientific (2 mentions)
Primer express software, by Thermo Fisher Scientific (2 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Pcr thermal cycler dice, by Takara Bio (2 mentions)
108 protocols using easy blue total rna extraction kit
1
Influenza A Virus Gene Expression Analysis
2
Gene Expression Analysis of Cytokines and Xenobiotic Metabolism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using easy-BLUE™ Total RNA Extraction Kits (iNtRON Biotechnology, Sungnam, Gyeonggi, Korea). Reverse transcription was performed using Reverse Transcriptase Premix (Elpis Biotech). qRT-PCR was performed with an ABI 7500 FAST instrument (Applied Biosystems, Foster City, CA, USA) using GoTaq® Master Mix (Promega, Madison, WI, USA). The gene expression levels were determined by normalizing to GAPDH using the 2–ΔΔCT method. The following primers were used: GAPDH: F, AGCCACATCGCTCAGACAC; R, GCCCAATACGACCAAATCC; CYP1A1: F, TGAACCCCAGGGTACAGAGA; R, GGCCTCCATATAGGGCAGAT; IL-6: F, AACCTGAACCTTCCAAAGATGG; R, TCTGGCTTGTTCCTCACTACT; and IL-8: F, AAGAGAGCTCTGTCTGGACC; R, GATATTCTCTTGGCCCTTGG.
3
Quantitative PCR of Mouse Bone Tissues
4
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using an Easy Blue total RNA extraction kit (Intron Biotechnology, Gyeonggi-do, Korea) we isolated total RNA from the HMC-1 cells in accordance with the specifications of the manufacturer. The total RNA was dissolved in DEPC-treated distilled water. A spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) was used to assess RNA purity by measuring the ratio of the absorbance at 260 and 280 nm; only RNA samples with a value in the 1.6-2.0 range were used. A cDNA synthesis kit (Qiagen, Valencia, CA, USA) was used for 2 min at 42˚C, 30 min at 42˚C, and 30 min at 95˚C to reverse transcribe each sample into cDNA. The primer sequences were as follows: IL-6 forward, 5'-GATGGATGCTTCCA ATCTGGAT-3' and reverse, 5'-AGTTCTCCATAGAGAA CAACATA-3'; IL-8 forward, 5'-TGTGCTCTCCAAAT TTTTTTTACTG-3' and reverse, 5'-CTCTCTTTCCTCTTT AATGTCCAGC-3; TNF-α forward, 5'-CACCAGCTGGTTA TCTCTCAGCTC-3' and reverse, 5'-CGGGACGTGGA GCTGGCCGAGGAG-3'; glyceraldehyde 3-phosphate dehydrogenase (GAPDH) forward, 5'CCATGTTCGTCAT GGGTGTGAACCA-3' and reverse, 5'-GCCAGTAGAGG CAGGGATGATGTTC-3'. Finally, following electrophoresis on a 2% agarose gel, the expression levels were confirmed using a UV detector (ImageQuant LAS 500; GE Healthcare Life Science, Chicago, IL, USA).
5
Quantitative Real-time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using an easy-BLUE total RNA extraction kit (iNtRON Biotechnology) according to the manufacturer's instructions. Realtime PCR amplifications were performed as previously described. 8, 17 The primers used for PCR were as follows: IL-10 (245 bp) sense, 5′-tgccttcagtcaag tgaagac-3′, and antisense, 5′-aaactcattcatggccttgta-3′; TGF-β (205 bp) sense, 5′-tgtcttttgacgtcactggagttgt-3′, and antisense, 5′-ggggtggccatgaggagcagg-3′; DDAH-1 (181 bp) sense, 5′-cgcaatagggtccagtgaat-3′, and antisense, 5′-ttgcgctttctgggtactct-3′; CCL5 (110 bp) sense, 5′-cgtgaaggagtatttttacaccagc-3′, and antisense, 5′-cttgaacccacttcttctctggg-3′; 12-LO (312 bp) sense, 5′-tggggcaac tggaagg-3′, and antisense, 5′-agagcgcttcagcaccat-3′; ET-1 (370 bp) sense, 5′-ctcctccttgatggacaagg-3′, and antisense, 5′-cttgatgctgttgctgatgg-3′; AT 1 R (445 bp) sense, 5′-cacctatgtaagatcgcttc-3′, and antisense, 5′-gcacaatcgccataatta tcc-3′; AT 2 R (65 bp) sense, 5′-ccgtgaccaagtcttgaagatg-3′, and antisense, 5′-agg gaagccagcaaatgatg-3′; and β-actin (101 bp) sense, 5′-tactgccctggctcctagca-3′, and antisense, 5′-tggacagtgaggccaggatag-3′. The mRNA levels of IL-10, TGF-β, DDAH-1, AT 1 R, AT 2 R, 12-LO and ET-1 were determined by comparing their experimental levels to standard curves, and were expressed as relative fold expression levels.
6
UVB-Induced MMP-1 Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were seeded on a 60 mm culture dish at 1 × 105 cells/mL. At sixteen hours after seeding, cells were treated with BDB (30 μM). After 1 h, the cells were exposed to UVB at a dose of 30 mJ/cm2. After 24 h, total RNA was isolated from the cells using easy-BLUE™ total RNA extraction kit (iNtRON Biotechnology, Seoul, Korea). The PCR of MMP-1 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were performed as follows: 35 cycles at 94 °C for 20 s, at 55°C for 30 s, and then at 72 °C for 40 s. The primer pairs were designed as follows: human MMP-1 (Bionics, Seoul, Korea), sense 5′-GGAGGAAATCTTGCTCAT-3′ and antisense 5′-CTCAGAAAGAGCAGCATC-3′; and human GAPDH (Bionics), sense 5′-AAGGTCGGAGTCAACGGATTT-3′ and antisense 5′-GCAGTGAGGGTCTCTCTCCT-3′. They were analyzed with image software after gel electrophoresis and staining.
7
Liver Fibrosis Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse liver tissues were collected, and total RNA was extracted using an Easy-BLUE Total RNA Extraction Kit (iNtrON Biotechnology, Korea) according to the manufacturer's instructions. Fibrotic gene expression was assessed by quantitative reverse-transcription polymerase chain reaction (RT-PCR) (Brilliant II QRT-PCR Master Mix Kit, 1-Step, Agilent, CA, USA) using specific primers (Table 1 ).
8
Apoptosis Pathway Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed in 1 ml of solution with a easy-BLUE Total RNA Extraction Kit (iNtRON Biotechnology), and RNA was isolated according to the manufacturer’s instructions. Oligo (dT)-primed RNA (5 μg) was reverse transcribed using M-MuLV reverse transcriptase (New England Biolabs, USA). Reverse transcription polymerase chain reaction (RT-PCR) was performed on a PCR Thermal Cycler Dice (Takara Bio Inc., Japan) by using the following primer sets: DR3 F 5’- CAG ATG TTC TGG GTC CAG GT-3’ and DR3 R 5’-GCT GTC CAA GGG TGA CAG AT-3’, FADD F 5’-CAC AGA CCA CCT GCT TCT GA-3’ and FADD R 5’-CTG GAC ACG GTT CCA ACT TT-3’, Fas F 5’- ATA AGC CCT GTC CTC CAG GT-3’, Fas R 5’- TGG AAG AAA AAT GGG CTT TG-3’, TRAIL F 5’-GGA ACC CAA GGT GGG TAG AT-3’, TRAIL R 5’-TCT CAC ACT GCA ACC TC-3’, and GAPDH F 5’-GAG TCA ACG GAT TTG GTC GT-3’, GAPDH R 5’-GAC AAG CTT CCC GTT CTC AG-3’.
9
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells by using Total RNA preparation kits (easy-Blue Total RNA Extraction kit, iNtRON Biotechnology, Seongnam, Korea) following the manufacturer’s protocol. The RNA was reverse transcribed to cDNA by reverse transcriptase (Invitrogen, Carlsbad, CA, USA). Quantitative real-time PCR (qPCR) was used to determine the mRNA levels of target genes by running on a StepOnePlus machine (Applied Biosystems, Foster City, CA, USA). The SYBR Green fluorescence probe system (KAPA Biosystems, Woburn, MA, USA) was used for determining the threshold cycle (CT) of target genes. Primers of human VCAM-1 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were purchased from Sigma-Aldrich. The expression levels of the target genes were normalized to GAPDH levels and the formula of level ratio = 2−ΔΔCt, where ΔΔCt = (Ct target−Ct GADPH)Sample−(Ct target−Ct GADPH)Control, was used for calculation. The data were represented with three independent experiments with triplicate of each sample.
10
Real-time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated using an easy-BLUE total RNA extraction kit (iNtRON Biotechnology, Seongnam-Si, Korea). A quantification and purity check of the RNA was performed based on an absorbance rate of A260/A280. 5 μg aliquots of total RNA were reverse transcribed into cDNA using moloney-murine leukemia virus (M-MLV) reverse transcriptase (Promega, WI, USA). The cDNA (1 μl RT product) was analyzed through real-time PCR using a StepOne Real-Time PCR system (Applied Biosystems, NY, USA) with SYBER Green TOPreal™ qPCR 2X PreMIX (Enzynomics, Daejeon, Korea). The gene primer sequences for real-time PCR are presented in Table 2 . The amplification conditions of these genes were as follows: 95°C for 15 min, followed by 40 cycles at 95°C for 15 s, 60°C for 10 s, and 72°C for 15 s. The β-actin was used as a control for normalization.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!