Total RNA was extracted using Trizol (Invitrogen) according to the manufacturer’s instructions. For mRNA analysis, real-time PCR was performed using Power SYBR_ green PCR master mix (Applied Biosystems) on an ABI 7500 series PCR machine Applied Biosystems, and data were normalized to GAPDH expression and further normalized to the negative control unless otherwise indicated. Custom primers for E-cadherin, N-cadherin, vimentin and ZEB1, Oct4 and Nanog were synthesized by Ruian biotech. E-cadherin forward primer 5′-GACCGAGAGAGTTTCCCTACG-3′, reverse primer 5′-TCAGGCACCTGACCCTTGTA-3′; N-cadherin forward primer 5′-GAGATCCTACTGGACGGTTCG-3′, reverse primer 5′-TCTTGGCGAATGATCTTAGGA-3′; vimentin forward primer 5′-CCTTGAACGCAAAGTGGAATC-3′, reverse primer 5′-TGAGGTCAGGCTTGGAAACAT-3′; ZEB1 forward primer 5′-GGAATGTATGCTTGTGATTTGTG-3′, reverse primer 5′-CTCTCTTACAGTAGGAGTAGCGATG-3′; Oct4 forward primer 5′-ATTCAGCCAAACGACCATCT-3′, reverse primer 5′-TCTCACTCGGTTCTCGATACTG-3′; Nanog forward primer 5′-AAGAACTCTCCAACATCCTGAAC-3′, reverse primer 5′-CCTTCTGCGTCACACCATT-3′.
Abi 7500 series pcr machine
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI 7500 series PCR machine is a versatile real-time PCR system designed for a wide range of applications. It utilizes thermal cycler technology to perform polymerase chain reaction (PCR) amplification and detection of nucleic acid sequences. The system provides accurate temperature control and precise data collection for reliable gene expression analysis, genotyping, and other quantitative PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Power sybr green pcr master mix, by Thermo Fisher Scientific (5 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Miscript pcr kit, by Qiagen (2 mentions)
Miscript reverse transcription kit, by Qiagen (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Sybr green mix, by Thermo Fisher Scientific (1 mentions)
Sybr select master mix, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Quant one step qrt pcr kit sybr green, by Tiangen Biotech (1 mentions)
7 protocols using abi 7500 series pcr machine
1
Quantitative Analysis of Epithelial-Mesenchymal Transition Markers
2
Quantitative Analysis of FOXP3 and ARHGAP15 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol (Invitrogen) was used to extract total RNA from transfected cells according to the manufacturer's instructions. Complementary DNA was obtained using the cDNA Reverse Transcription Kit (Invitrogen). Real‐time PCR was carried out using Power SYBR green PCR master mix (Applied Biosystems, Carlsbad, USA) on an ABI 7500 series PCR machine (Applied Biosystems); GAPDH was used an endogenous control. The primers designed for quantitative real‐time RT‐PCR analysis were as follows: FOXP3, 5′‐CACAACATGCGACCCCCTTTCACC‐3′ (forward) and 5′‐AGGTTGTGGCGGATGGCGTTCTTC‐3′ (reverse); and ARHGAP15, 5‐′CGGGATCCATGCAGAAATCTACAAAATC‐3′ (forward) and 5′‐TCCCCCGGGCATCAAGACAGATGTG‐3′ (reverse).
3
Total RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by Trizol reagent (Invitrogen) according to the manufacturer’s instructions. For mRNA analysis, qRT-PCR was performed using Power SYBR_ green PCR master mix (Applied Biosystems) on an ABI 7500 series PCR machine Applied Biosystems using the specific primers (Supplementary Table 3 ). For miR-378a-3p expression assay, total RNA was reverse transcribed using the miScript Reverse Transcription Kit (Qiagen, Valencia, CA). qRT-PCR amplification for miR-378a-3p was performed using the miScript PCR Kit (Qiagen) using the specific primers (Supplementary Table 3 ). Experiments were normalized to U6.
4
Quantifying mRNA and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by Trizol (Invitrogen) according to the manufacturer's instructions. For mRNA analysis, qRT‐PCR was performed using Power SYBR_ green PCR master mix (Applied Biosystems) on an ABI 7500 series PCR machine Applied Biosystems using the specific primers (Table S3 ). For miR‐2355‐5p expression assay, total RNA was reverse transcribed using the miScript Reverse Transcription Kit (Qiagen, Valencia, CA). qRT‐PCR amplification for miR‐2355‐5p was performed using the miScript PCR Kit (Qiagen) using the specific primers(Table S3 ). Experiments were normalized to U6.
5
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from CT26 cells using RNeasy Mini Kit (Qiagen, Dusseldorf, Germany). cDNAs were synthesized using PrimeScript™ RT reagent Kit (Takara, Dalian, China) and real-time PCR was performed using SYBR® Select Master Mix (Applied Biosystems, Foster, CA, USA) on an ABI 7500 series PCR machine (Applied Biosystems). Primer pairs (Table 1 ) were used to detect target gene transcripts.
The PCR mixture used for quantitative cDNA amplification contained 1 μL cDNA (1:10 dilution), 5 μL SYBR Green Mix (Applied Biosystems), 0.3 μL of each primer (sense and antisense, 10 μM) and 3.4 μL nuclease-free water. The reaction mixture was heated to 50 °C for two minutes, 95 °C for two minutes, and cycled (15 s at 95 °C; 31 s at 60 °C) for 40 cycles. Fluorescent data for quantification was collected at 72 °C. Melting curve analysis was performed over a range of 60–95 °C in order to verify single product amplification at the end of the assay. All samples were tested in triplicate and the amount of mRNA detected was normalized to GAPDH transcription level.
The PCR mixture used for quantitative cDNA amplification contained 1 μL cDNA (1:10 dilution), 5 μL SYBR Green Mix (Applied Biosystems), 0.3 μL of each primer (sense and antisense, 10 μM) and 3.4 μL nuclease-free water. The reaction mixture was heated to 50 °C for two minutes, 95 °C for two minutes, and cycled (15 s at 95 °C; 31 s at 60 °C) for 40 cycles. Fluorescent data for quantification was collected at 72 °C. Melting curve analysis was performed over a range of 60–95 °C in order to verify single product amplification at the end of the assay. All samples were tested in triplicate and the amount of mRNA detected was normalized to GAPDH transcription level.
6
Total RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol reagent (Invitrogen Life Technologies, Carslbad, CA, USA) according to the manufacturer's protocol. qRT-PCR was performed by Quant one step qRT-PCR Kit (SYBR Green) (TIANGEN BIOTECH CO., LTD, Beijing, China) in an ABI 7500 series PCR machine Applied Biosystems using the following primers: Ctr1F: 5′-AAGATAGCCCGAGAGAGCCT-3′, Ctr1R: 5′-TGGATGATGTG CAGCACTGC-3′ (product size: 176 bp), GAPDHF: 5′-GGGAGCCAAAAGGGT CATCA-3′, GAPDHR: 5′-AGTGATGGCATGGACTGTGG-3′.
7
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol (Invitrogen) according to the manufacturer's instructions. For mRNA analysis, real-time PCR was performed using the Power SYBR green PCR master mix (Applied Biosystems) with an ABI 7500 series PCR machine (Applied Biosystems), and the data were normalized to GAPDH expression and then further normalized to the negative control, unless otherwise indicated. Custom primers for TUBB3, STMN1, TS, MDR1, and MRP were synthesized by Ruian Biotech (GAPDH forward primer 5′-CCATGGAGAAGGCTGGGG-3′ and reverse primer 5′-CAAAGTTGTCATGGATGACC-3′; TUBB3 forward primer 5′-GCCTGACAATTTCATCTTT-3′ and reverse primer 5′-TCACACTCCTT CCGCACCA-3′; STMN1 forward primer 5′-AGAATACACTGCCTGTCGCTT G-3′ and reverse primer 5′-AGGCACGCTTCTCCAGTT-3′; TS forward primer 5′-ACCTGAATCACAATC GAGCCA-3′ and reverse primer 5′-TTG GATGCGGATTGTACCCT-3′; MDR1 forward primer 5′-CACGTCAGCCTTGGA CACAGA-3′ and reverse primer 5′-CAA TGACTCCATCATCGAAACCAG-3′; MRP forward primer 5′-TCTCTCCCGACATGACCGAGG-3′ and reverse primer 5′-CCAGGAATATGCCCCGACTTC-3′).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!