Nis element 4

Bimolecular fluorescence complementation assay (BiFC) was performed using pSPYNE, and pSPYCE vectors were obtained from the Arabidopsis Biological Resource Center. The ChiLCV ORF C1 was amplified using forward primer 5′‐GGTACCGCCATCGATTTGGAAAACTCC‐3′ and reverse primer 5′‐GGTACCATAAACCTCCAACGGAGGTG‐3′, and cloned into the pSPYCE vector at KpnI and XhoI sites. Similarly, NbPI4KII was amplified using forward primer 5′‐GTCGACATGTCGAGGAACTTAGACAGT‐3′ and reverse primer: 5′‐CCCGGGTCAAAACTGGCATGAAGTGCC‐3′, and cloned into the pSPYNE vector at the SalI and XmaI sites. The pSCPYCE‐Rep, pSPYNE‐NbPI4KII constructs were transformed into A. tumefaciens strain GV2260. BiFC assay was done by co‐infiltration of pSPYCE‐REP with pSPYNE‐NbPI4KII into the lower epidermis of N. benthamiana following Kushwaha et al. (2017). In vivo expression was observed under a confocal microscope (Model Eclipse TiE, Nikon, Tokyo, Japan). NIS‐Element 4.0 software (Nikon, Tokyo, Japan) was also used to subtract the background signals.

A bimolecular fluorescence complementation assay (BiFC) was performed using pSPYNE, and pSPYCE vectors that were obtained from the Arabidopsis Biological Resource Center [85 (link)]. The ORF C1 of ChiLCV was amplified using primer pair no. 10 (S2 Table) and cloned into the pSPYCE vector at KpnI and XhoI sites. NbHUB1 was amplified using primer pair no. 6 (S2 Table) and cloned into the pSPYNE vector at the KpnI and SalI sites. NbUBC2 was cloned into the pSPYNE vector at the KpnI and BamHI sites using primer pair no. 28 (S2 Table). The NbH2B sequence was amplified using primer pair no. 27 (S2 Table) and cloned into the pSPYCE vector at the KpnI and BamHI sites. The pSCPYCE-Rep, pSPYNE-NbUBC2 and pSPYNE-NbHUB1 constructs were transferred into A. tumefaciens strain GV2260 as previously described. For the BiFC assay, pSPYCE-REP with pSPYNE-NbUBC2, pSPYCE-REP with pSPYNE-NbHUB1, and pSPYCE-NbH2B with pSPYNE-NbHUB1 were co-infiltrated onto the lower epidermis of N. benthamiana. In vivo expression was observed under a confocal microscope (Model Eclipse TiE, Nikon, Tokyo, Japan). NIS-Element 4.0 software (Nikon, Tokyo, Japan) was used to subtract the background signals.

Twenty-micrometre sections were obtained by cutting isopentane fresh-frozen tibialis anterior muscle perpendicular to the muscle axis with a cryostat at −20 °C (Leica, Nanterre, France). Acetylcholine receptors in the postsynaptic apparatus of neuromuscular junctions were labelled with rhodamine-conjugated α-bungarotoxin (Sigma–Aldrich). Gangliosides distribution was labelled with the cholera toxin sub-unit beta coupled with an Alexa488 dye (1/200, ThermoFisher). Photomicrographs were taken with a Nikon microscope and analysed with NIS Element 4.0 (Nikon).