For qRT-PCR with hydrolysis probes, the GAPDH primers were: GAAGGTGAAGGTCGGAGTC (forward), GAAGATGGTGATG GGATTTC (reverse), and CAAGCTTCCCGTTCTCAGCC (probe). The STMN2 cryptic exon primers were CTTTCTCTAGCACGG TCCCAC (forward), ATGCTCACACAGAGAGCCAAATTC (reverse), and CTCTCGAAGGTCTTCTGCCG (probe). cDNA, primers, and iTaq (BioRad 1725131) were mixed together and analyzed using a BioRad CFX96 PCR system.
Cfx96 pcr system
The CFX96 PCR system is a real-time PCR detection system designed for quantitative gene expression analysis and genetic variation studies. It features a 96-well thermal cycler that supports fast and sensitive DNA amplification and detection. The system is capable of performing various real-time PCR applications, including gene expression profiling, genotyping, and high-resolution melt analysis.
Lab products found in correlation
186 protocols using cfx96 pcr system
RNA Extraction, Reverse Transcription, and qRT-PCR
Gene Expression Validation by qRT-PCR
Hepatic Cytochrome P450 Expression
Quantitative Gene Expression Analysis
Quantitative RT-PCR for Gene Expression
Validating lncRNA Expression via RT-qPCR
The comparative quantification cycle (Cq) method was employed to quantify the relative expression of lncRNAs. The expression levels of the lncRNAs were analysed as FC values using the ΔCq method (27 (link)). All data were log transformed, and the results were comparable to the RNA-Seq data.
Quantitative RT-PCR for PINK1 gene expression
Quantitative RT-PCR Analysis of Gene Expression
Quantifying Gene and miRNA Expression
RNA Extraction and RT-qPCR Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!