After 7 days, total RNA was obtained from lysed cells according to manufacturer’s instructions (Promega ReliaPrep Cell Miniprep kit). Gene expression was measured directly from 5 ng RNA using a one-step QPCR kit with SYBR dye (PrimerDesign). A list of the forward and reverse primers used to study different mouse genes is provided in Supplementary Table 7 . QPCR was run on the BioRad CFX96 platform. Relative gene expression was normalized to the 18S ribosomal RNA reference gene. Gene expression was measured at least twice from each independent experiment. One-way analysis of variance (ANOVA) with Tukey’s post-hoc test for multiple comparisons was performed to determine the effect of nanotopography on gene expression compared with FLAT. Statistical significance was considered at p < 0.05. Plotting and statistical testing of gene expression data were performed using GraphPad Prism (v7.0a).
Cfx96 platform
Manufactured by Bio-Rad
Sourced in United States, China
The CFX96 platform is a real-time PCR detection system developed by Bio-Rad. It is designed to perform quantitative PCR (qPCR) analysis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (9 mentions)
High capacity reverse transcription kit, by Thermo Fisher Scientific (5 mentions)
Itaq universal sybr green supermix, by Bio-Rad (5 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Top green qpcr supermix, by Transgene (3 mentions)
Ssofast evagreen supermix, by Bio-Rad (3 mentions)
Maxima h minus reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Bullseye evergreen, by MidSci (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (2 mentions)
Sybr green reagent, by Bio-Rad (2 mentions)
Random hexamer, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Bio-Rad (2 mentions)
Rneasy kit, by Qiagen (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Qiaamp dna stool mini kit, by Qiagen (2 mentions)
Qiaamp viral rna mini kit, by Qiagen (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
54 protocols using cfx96 platform
1
Quantifying Nanoengineered Cell Gene Expression
2
Validating Transcript Expression by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transcript expression of two target genes (cytochrome P450 6 K1 isoform X1 and UDP‐glucuronosyltransferase), quantified using the MonsterPlex‐targeted RNA sequence methodology, were validated by a quantitative polymerase chain reaction (qPCR) using an aliquot of the cDNA submitted to Floodlight Genomics. Ribosomal protein 4 was used as a reference gene in the analysis. The qPCR were run on a CFX‐96 platform (Bio‐Rad Laboratories) with a master mix of Bullseye EverGreen (MIDSCI). The qPCR were conducted using the Pfaffl efficiency calibrated methodology; primer and primer efficiency24 can be found in Table S5 . Triplicate reactions were run at 95°C for 10 min, followed by 95°C for 15 s, and 62°C for 60 s for a total of 40 cycles. Mean cycle threshold (Ct) values were collected for each biological replicate and fold change estimates between the insecticide susceptible and putative resistant, or unknown populations were calculated. A two‐tailed Student's t‐test was conducted to determine if transcript expression differed between treatment groups and a value of P ≤ 0.05 was considered statistically significant. A correlation regression was conducted to determine if the targeted RNA sequencing data was significantly different from, or similar to the qPCR obtained in JMP. A correlation of P ≤ 0.05 was used to determine if there was significant correlation.
3
Gene Expression Analysis of Immune Markers
4
Gene Expression Analysis by RT-qPCR
5
Quantitative PCR for Leishmania Parasite Load
6
Detection of Ureaplasma in Infant Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Microbiological samples were obtained by tracheal aspiration (intubated infants) or nasopharyngeal swabs (non-intubated infants). In 2009 and 2010, 36 patient samples were tested with the Mycofast Screening Revolution (EliTech Diagnostic, Puteaux, France) assay based on liquid broth cultures performed according to the manufacturer’s instructions. The samples were further inoculated and cultured on a mycoplasma-selective A8 agar plate. After 24-48 hours of incubation, Ureaplasma colonies were observed with a stereomicroscope at 60 × magnification. In 2011, 13 (62%) samples were cultured as described, and six (29%) samples were tested with a specific multiplex real-time polymerase chain reaction (PCR, Allplex STI Essential Assay, Seegene, Seoul, South Korea). Two (9%) samples were both cultured and tested with PCR. DNA was extracted from the specimens by using the automated MagNA Pure Compact instrument and the MagNA Pure Compact Nucleic Acid Isolation Kit I with Bacteria Lysis Buffer and Proteinase K (all from Roche Diagnostics, Mannheim, Germany) pretreatment. Real-time PCR was performed on a CFX96 platform (Bio-Rad, Marnes-la-Coquette, France) according to the manufacturer´s instructions. In 2012 and afterwards, all the samples were tested with specific multiplex real-time PCR.
7
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from tissues were isolated using NucleoSpin RNA Plus kit (Macherey-Negel, Dueren, Germany), and cDNA was generated with Maxima H Minus Reverse Transcriptase (Thermo Fisher). Reverse transcription PCR data were analyzed using the 2ΔΔct method with the SYBR Green Chemistry (ThermoFisher) reagent, with Gapdh gene serving as the endogenous housekeeping gene. Samples were normalized to naive controls. Quantitative real-time PCR was run and analyzed on CFX96 platform (Bio-Rad, Hercules, CA). Primers used are listed in Key Resources Table .
8
Quantitative RT-PCR Analysis of ADAR and F5 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
F5 was detected using a Fam labeled Taqman probe and primer set (Mm00484202_m1) and human ADAR expression was detected using probe and primer sets ADAR1 (Hs00241666_m1) and ADAR2 (Hs00953724_m1), and rhesus ADAR expression was detected with probes for ADAR1 (Hs00241666_m1) and ADAR2 (Rh00955199_m1). For qRT-PCR, first strand cDNA was synthesized using random primers using the High-Capacity Reverse Transcription Kit and expression was analyzed according to manufacturer’s instructions for Taqman real-time PCR (Applied Biosystems, Forster City, CA) on a CFX96 platform (Biorad, Hercules, CA). Parallel amplification efficiencies were verified by PCR miner algorithm [24 (link)] and data was analyzed by CFX manager (Biorad, Hercules, CA).
9
Quantification of Stem Cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol (ThermoFisher, Canoga Park, CA, USA), and reverse transcription reaction was carried out using High Capacity Reverse Transcription Kit (Thermo Fisher, Canoga Park, CA, USA). Real-time quantitative PCR (RT-qPCR) was used for quantifying mRNA levels using the iTaq Universal SYBR Green Supermix (BioRad, Hercules, CA, USA) and BioRad cfx96 platform according to the manufacturer’s protocol. Gene expression levels were normalized to that of GAPDH. Primers were purchased from Integrated DNA technologies (IDT), Coralville, IA, USA. The sequences of primers used for RT-PCR were as follow: h-Oct4-F; GAGAATTTGTTCCTGCAGTGC, h-Oct4-R; GTTC CCAATTCCTTCCTTAGTG, h-CD133-F; GAGTCGGAAACTGGCAGATAGCA, h-CD133-R; ACGCCTTGTCCTTGGTAGTGTTG, h-Nanog-F; ACCTATGCC TGTGATTTGTGG, h-Nanog-R; AAGAGTAGAGGCTGGGGTAGG, h-YAP-F; TAGCCCTGCGTAGCCAGTTA, h-YAP-R; TCATGCTTAGTCCACTGTCTGT, h-GAPDH-F; CCAGGTGGTCTCCTCTGACTTCAACA, h-GAPDH-R; AGGGTC TCTCTCTTCCTCTTGTGCTC.
10
RNA Isolation and Quantification from Caco2 and LS174T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolation of RNA from Caco2 and LS174T cells and quantitation of specific mRNAs was performed, as previously described [17 (link)]. Briefly, 1 mL Tri Reagent (Sigma) was added to PBS-washed cells, and homogenates were transferred to 1.5 mL tubes.
A volume of 0.2 mL chloroform (Sigma) was added to the homogenates, shaken vigorously for 15 s, and centrifuged (12,000× g, 15 min, 4 °C). Aqueous supernatants (0.4 mL) were transferred to fresh tubes and precipitated by addition of 0.5 mL 100% isopropanol (Fisher Chemical) followed by centrifugation (16,000× g, 30 min, 4 °C). Total RNA pellets were washed with 0.5 mL 70% ethanol (Fisher Chemical) and centrifuged (8000× g, 5 min, 4 °C). Total RNA pellets were air-dried and solubilized in 0.1 mL AmbionTM DEPC-treated water (Invitrogen, Waltham, MA, USA). Total RNA concentration was determined using Nanodrop (Thermo Fisher Scientific, Waltham, MA, USA). Furthermore, 1 mg total RNA was converted to cDNA using a High-Capacity cDNA Reverse Transcription Kit, following the manufacturer’s instructions (Applied Biosystems, Waltham, MA, USA). Quantitative PCR was performed using PerFecTa SYBR green reagent (Thermo Fisher Scientific), following manufacturer’s instructions, on a CFX96 platform (BioRad, Hercules Scientific). Oligonucleotide primers (IDT DNA) utilized for quantitative PCR are presented inSupplementary Table S1 .
A volume of 0.2 mL chloroform (Sigma) was added to the homogenates, shaken vigorously for 15 s, and centrifuged (12,000× g, 15 min, 4 °C). Aqueous supernatants (0.4 mL) were transferred to fresh tubes and precipitated by addition of 0.5 mL 100% isopropanol (Fisher Chemical) followed by centrifugation (16,000× g, 30 min, 4 °C). Total RNA pellets were washed with 0.5 mL 70% ethanol (Fisher Chemical) and centrifuged (8000× g, 5 min, 4 °C). Total RNA pellets were air-dried and solubilized in 0.1 mL AmbionTM DEPC-treated water (Invitrogen, Waltham, MA, USA). Total RNA concentration was determined using Nanodrop (Thermo Fisher Scientific, Waltham, MA, USA). Furthermore, 1 mg total RNA was converted to cDNA using a High-Capacity cDNA Reverse Transcription Kit, following the manufacturer’s instructions (Applied Biosystems, Waltham, MA, USA). Quantitative PCR was performed using PerFecTa SYBR green reagent (Thermo Fisher Scientific), following manufacturer’s instructions, on a CFX96 platform (BioRad, Hercules Scientific). Oligonucleotide primers (IDT DNA) utilized for quantitative PCR are presented in
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!