Sybr green reagent

The samples were prepared as previously described [45 (link)]. Briefly, total RNA was isolated from each cell line homogenized in Trizol reagent (Thermofisher) using RNeasy Mini Kit (Qiagen) according to the manufacturer’s instruction. RNA was reverse-transcribed to synthesize cDNA using iScript cDNA Synthesis kit (Bio-rad). Real-time quantitative PCR was performed on a CFX instrument (Bio-rad) with SYBR Green reagent (Bio-rad) and specific primers as followed: KRT18-forward, 5′-CAGAGACTGGAGCCATTACTTC-3′; KRT18-reverse, 5′-GCCAGCTCTGTCTCATACTTG-3′; CDH1-forward, 5′-CTGCCAATCCCGATGAAATTG-3′; CDH1-reverse, 5′-TCCTTCATAGTCAAACACGAGC-3′; CDH2-forward, 5′-CCCAAGACAAAGAGACCCAG-3′; CDH2-reverse, 5′-GCCACTGTGCTTACTGAATTG-3′; VIM-forward, 5′-ACCCTGCAATCTTTCAGACAG-3′; VIM-reverse, 5′-GATTCCACTTTGCGTTCAAGG-3′; FN1-forward, 5′-GTGGCAGAAGGAATATCTCGG-3′; FN1-reverse, 5′-GAGAATACTGGTTGTAGGACTGG-3′; CTGF-forward, 5′-CGACTGGAAGACACGTTTGG-3′; CTGF-reverse, 5′-AGGCTTGGAGATTTTGGGAG-3′; CYR61-forward, 5′-GAGTGGGTCTGTGACGAGGAT-3′; CYR61-reverse, 5′-GGTTGTATAGGATGCGAGGCT-3′; AXL-forward, 5′-TTTATGACTATCTGCGCCAGG-3′; AXL-reverse 5′-TGTGTTCTCCAAATCTTCCCG-3′; AMOTL2-forward 5′-GACTTCAACCGGGATCTTAGAG-3′; AMOTL2-reverse 5′-CCAGCTTCTCTTGCTCCTG-3′; 18 s RNA-forward, 5′-GTAACCCGTTGAACCCCATT-3′; 18 s RNA-reverse, 5′-CCATCCAATCGGTAGTAGCG-3′.

These methods were, aside from minor changes, performed as described previously (Devi et al., 2012 (link), 2013 (link), 2017 (link)). For total protein extraction and western blotting, RIPA buffer was used as were precast polyacrylamide gels from BioRad. ImageJ was used to quantitate the blots. Trizol (Ambion) was used to isolate total RNA whereas the iScript™ cDNA Synthesis Kit and SYBR Green reagent (BioRad, Hercules, USA) were used for cDNA synthesis and qPCR detection. The MitoProbe™ JC-1 Assay Kit (Cat# M34152) and ATP Determination Kit (Cat# A22066) were purchased from Thermo Fisher Scientific and used according to their instructions. Cell viability was measured using a fluorescence plate reader and the LIVE/DEAD™ Viability/Cytotoxicity Kit for mammalian cells (Cat# L3224, Invitrogen). For the caspase-1 and cathepsin L assays, the FAM-FLICA^® Caspase-1 Assay Kit and Magic Red Cathepsin L Assay Kit, respectively, were purchased from Immunohistochemistry Technologies (Bloomington, USA).

Some of the core differentially expressed lncRNAs and mRNAs identified in microarray analysis were validated by RT-qPCR. The gene primers are listed in Additional file 1: Table S1. The housekeeping gene GAPDH was used as an internal control. We performed RT-qPCR using SYBR green reagent (Bio-Rad, Hercules, CA, USA) as per the manufacturer’s instructions and calculated the sample mean to ensure data stability. The relative expression levels of lncRNAs and mRNAs were calculated using the comparative CT method (2^−ΔΔCT).

Total RNA form lung tissue was extracted using Trizol regent (TaKara, Japan), 1000 ng RNA was reverse transcribed with Superscript. Subsequently, qRT-PCR was performed with SYBR green reagent on Bio-rad real time PCR system. Primers used for measuring gene expression were shown below: IL-1β(forward, TGACAGTGAGAATGACCTGTTC; reverse, TTGGATGACCCTCTTAHTHTTC), TNF-α (forward, ACAGCAAGGGACTAGCCAGGAG; reverse, GGAGTGCCTCTTCTGCCAGT) and β-actin ( forward CCCTAAGGCCAACCGTGAAA; reverse ACGACCAAGGCATACAGGGA).