Platinum sybr green qrt pcr supermix udg kit

qRT‐PCR was performed using the Rotor-Gene Q 5plex HRM thermal cycler (Qiagen,
Germany). Each 15-μL reaction contained 100 ng cDNA, 0.3 μL gene-specific forward and
reverse primers (10 μM), and 7.5 μL Platinum Sybr Green qRT‐PCR SuperMix-UDG kit
(Invitrogen). The cycling conditions were as follows: initial template denaturation
for 5 min at 95°C, followed by 40 cycles of denaturation at 95°C for 20 s, annealing
at 60°C for 30 s, and extension at 72°C for 30 s. Fluorescence detection was
performed during each cycle at 72°C to identify the positive samples. Each sample was
assessed in triplicate, and controls without template were included in parallel for
each reaction. Amplification was followed by a melting curve analysis to check PCR
product specificity. The fold changes in gene expression relative to the levels
obtained in healthy rats, which were set equal to 1, were analyzed and calculated
using the 2^-ΔΔct method (13 (link)).

RNA isolation was performed using TRIzol Reagent (Thermo Fisher) and transcribed to cDNA using the Superscript III First-Strand Synthesis System (Invitrogen). Gene expression analysis was performed using the Platinum SYBR green qRT-PCR supermix-UDG kit (Invitrogen) in a ViiA 7 Real-Time PCR instrument (Thermo Fisher Scientific). Ribosomal protein L19 (RPL19) was used as a housekeeping gene for normalization. The following primer sets were used in this study: RPL19 5’ATTGGTCTCATTGGGGTCTAAC3’, 5’AGTATGCTCAGGCTTCAGAAGA3’; STAB2 5’GCAAGAAGATGTGATAGGAAGTCTC3’, 5’ACAACACCGAGGTTGGAGAT3’, LYVE1 5’TTTGCAGCCTATTGTTACAACTCAT3’, 5’GGGATGCCACCCAGTAGGTA3’ and CD31 5’TCTGCACTG CAGGTATTGACAA, 5’CTGATCGATTCGCAACGGA3’.