Sirnas

Manufactured by Polyplus Transfection

Sourced in France

SiRNAs (small interfering RNAs) are short, double-stranded RNA molecules that play a role in gene silencing. They are designed to target and degrade specific mRNA transcripts, thereby reducing the expression of targeted genes.

Automatically generated - may contain errors

Lab products found in correlation

Hispeed plasmid maxi kit, by Qiagen (1 mentions) Jetprime, by Polyplus Transfection (1 mentions) Jetprime transfection reagent, by Polyplus Transfection (1 mentions) Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions) Interferin, by Polyplus Transfection (1 mentions) Si nc, by Polyplus Transfection (1 mentions) Sh nc, by Genechem (1 mentions) Puromycin, by Merck Group (1 mentions) Sh nc, by Merck Group (1 mentions)

Spelling variants of this product

JetPRIME siRNA transfection reagent (9 citations) JetPRIME® in vitro DNA and siRNA transfection reagent (8 citations) INTERFERin in vitro siRNA transfection reagent (8 citations) JetPRIME™ DNA and siRNA Transfection Reagent (3 citations) NC-siRNA (2 citations) IRAK4 siRNA (2 citations) NT-siRNA (2 citations) JetPRIME in vitro siRNA transfection reagent (2 citations) H-AAMP-siRNA (1 citations) M-AAMP-siRNA (1 citations)

4 protocols using sirnas

MYCN Knockdown and Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small interfering RNAs (siRNAs) purchased from Ruibo (Guangzhou, China) were used to knock down MYCN. The sequences of siRNAs were:
NGP and BE2 cells were seeded 2 × 10⁵/ml in 6-well plate. The siRNAs were transfected into cells using jetPRIME (Polyplus Transfection, Illkirsch, France) and after 24 h, cells were treated with rapamycin and MK-2206.
MYCN expression plasmids were isolated using the HiSpeed Plasmid Maxi Kit (Qiagen, Germany) according to the manufacturer's instructions. AS and SY5Y cells (1 × 10⁵/ml) were seeded in 6-well plate and transfected with MYCN plasmids using jetPRIME. After 24 h, cells were treated with rapamycin and MK-2206.

Dong Y., Gong W., Hua Z., Chen B., Zhao G., Liu Z., Thiele C.J, & Li Z. (2020). Combination of Rapamycin and MK-2206 Induced Cell Death via Autophagy and Necroptosis in MYCN-Amplified Neuroblastoma Cell Lines. Frontiers in Pharmacology, 11, 31.

+ Open protocol

+ Expand

Silencing Tgm2 Using siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small interfering RNAs (siRNAs) against Tgm2 and its negative control were obtained from GenePharma, Inc. (Shanghai, China). The detailed sequences of siRNAs against Tgm2 were shown as follows: si-Tgm2-1, 5′-GGCAGAAGAUCAGACUAATT-3′; si-Tgm2-2, 5′-GCCUGAUGCUCUUGGAUAUAUTT-3′; and si-Ctrl, 5′-UUCUCCGAACGUGUCACGUTT-3′. Transient transfection was performed using the jetPRIME transfection reagent (114-15, Polyplus-transfection, France) according to the manufacturer's instructions. The knockdown efficiency of TGM2 in BV2 cells was evaluated by Western blotting. Constructs for mouse wide-type TGM2, transamidase-inactive TGM2 (C277S), and GTP-binding-inactive TG2 (R580A) were generated by GenePharma, Inc. (Shanghai, China) and cloned to the pcDNA3.1 plasmids for transfection. Transfection of these plasmids was performed with the Lipofectamine 2000 reagent (#11668-027, Invitrogen, USA) according to the manufacturer's protocol.

Hou Y., Xiao X., Yu W, & Qi S. (2021). Propofol Suppresses Microglia Inflammation by Targeting TGM2/NF-κB Signaling. Journal of Immunology Research, 2021, 4754454.

+ Open protocol

+ Expand

ADGRG1 Gene Silencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

ADGRG1−targeting small INTERFERing RNAs (si-RNAs) and negative control siRNAs (si−NC) were designed and synthesized by GenePharmaCorp. The ADGRG−siRNA sequences were as follows: siRNA-1428, 5’−GCAACCACUUGACCUACUUTT−3’; siRNA-1900, 5’−GGUGGAUGUGGACAACUAUTT−3’; siRNA-2178, 5’−CCUUUGCUUCUGGCACCU UTT−3’. The si−NC sequence was as follows: 5’−UUCUCCGAACGUGUCACGUTT−3’ (sense) and 5’−ACGUGACACGUUCGGAGA ATT−3’ (antisense). The si−RNAs and si−NC were transfected into Siha by INTERFERin (Polyplus Transfection) according to the manufacturer’s protocols. After 48 h, knockdown efficiency was evaluated by PCR and Western blotting. Lentiviruses carrying short hairpin RNA (shRNA: 5′‐GCAACCACTTGACCTACTT-3′) targeting ADGRG1 and negative control (shNC: 5′‐TTCTCCGAACGTGTCACGT-3′) were also synthesized by GenePharmaCorp.

Zhang S., Guo K., Liang Y., Wang K., Liu S, & Yang X. (2021). ADGRG1 Is a Predictor of Chemoresistance and Poor Survival in Cervical Squamous Carcinoma. Frontiers in Oncology, 11, 671895.

+ Open protocol

+ Expand

Silencing DIAPH3 via siRNA and shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

DIAPH3 was knocked down using siRNA (Sunya, Hangzhou, China). The siRNAs were mixed with jetPRIME transfection ingredients according to the manufacturer's protocol (Polyplus, New York, NY, USA) before being added into the corresponding dishes. Cells treated with siRNA for 48 h were used for further functional assays. The siRNA sequences were as follows: SiNC sense (UUCUCCGAACGUGUCACGUdTdT), si-NC antisense (ACGUGACAC-GUUCGGAGAAdTdT); si-DIAPH3–1 sense: CGUGUCAGAAUAGCUAAAGAATT; si-DIAPH3–1 antisense: UUCUUUAGCUAUUCUGACACGTT; si-DIAPH3–2 sense: GCUCAGUGCUAUUCUCUUUAATT; si-DIAPH3–2 antisense: UUAAAGAGAAUAGCACUGAGCTT; si-DIAPH3–3 sense: CAGAGUCCAUGAUUCAGAACUUAAUTT; si-DIAPH3–3 antisense: AUUAAGUUCUGAAUCAUGGACUCUGTT.
In order to construct stable DIAPH3 knockdown cell lines, sh-NC and sh-DIAPH3 lentivirus (derived from si-DIAPH3–1) were bought from Genechem company (Shanghai, China). The cells successfully transfected with sh-NC/sh-DIAPH3 lentivirus were screened using 5ug/ml puromycin (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for one week. The two pairs of oligonucleotides of sh-DIAPH3 were exhibited as follows: sh-DIAPH3:
F:
5′-CCGGCGTGTCAGAATAGCTAAAGAACTCGAGTTCTTTAGCTATTCTGACACGTTTTTG −3′.
R:
5′-AATTCAAAAACGTGTCAGAATAGCTAAAGAACTCGAGTTCTTTAGCTATTCTGACACG-3′.

Wu Y., Xu Z., Fu G., Chen X., Tian J., Cai H., Jiang P, & Jin B. (2024). Identification of a cisplatin resistant-based prognostic immune related gene signature in MIBC. Translational Oncology, 44, 101942.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!