Anti rna pol 2

Manufactured by Active Motif

Sourced in United Kingdom

The Anti-RNA Pol-II product is a research-use antibody that recognizes the RNA Polymerase II enzyme, which is responsible for the transcription of protein-coding genes in eukaryotic cells. This antibody can be used to study the localization, expression, and activity of RNA Polymerase II in various experimental systems.

Automatically generated - may contain errors

Lab products found in correlation

Anti ddx5, by Fortis Life Sciences (2 mentions) Sybr green 1 master mix, by Roche (2 mentions) Anti h3k4me3, by Abcam (2 mentions) Anti flag tag, by Merck Group (2 mentions) Anti ha tag, by Cell Signaling Technology (2 mentions) Subcellular protein fractionation kit, by Thermo Fisher Scientific (2 mentions) Light cycler 48011, by Roche (1 mentions) Lightcycler 480 2, by Roche (1 mentions) Anti cleaved caspase 7, by Cell Signaling Technology (1 mentions) Anti h3k4me3, by Merck Group (1 mentions) Anti sox2, by Cell Signaling Technology (1 mentions) Anti atg7, by Cell Signaling Technology (1 mentions) Anti gfap, by BD (1 mentions) Anti cleaved caspase 3, by Cell Signaling Technology (1 mentions) Anti atg5, by Merck Group (1 mentions) Anti g9a, by Abcam (1 mentions) Anti olig2, by Merck Group (1 mentions) Anti h3k9me2, by Abcam (1 mentions) Anti β actin peroxidase conjugated antibody, by Merck Group (1 mentions) Anti ulk1, by Santa Cruz Biotechnology (1 mentions)

5 protocols using anti rna pol 2

Chromatin Immunoprecipitation with qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 13

Conventional ChIP-qPCR was performed. Briefly, cells were crosslinked with 1% formaldehyde at room temperature for 10 minutes followed by glycine quenching, cell lysis, nuclei isolation and lysis, and sonication to obtain 150-200 bp DNA fragments. Complexes were immunoprecipitated overnight using 10 μg of anti-HA tag (Cell Signaling 3724), anti-Flag tag (Sigma F1804), anti-H3K4me3 (AbCam ab8580), anti-RNA Pol-II (Active Motif 61083), or anti-DDX5 (Bethyl A300-523A). Real-time qPCR of purified DNA was performed using SYBR Green I MasterMix (Roche 4707516001) on the Light Cycler 48011 (Roche). qPCR primers are provided in Table 9.

US11293018B2. Manipulation of nuclear architecture (2022-04-05). THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY [US], SYSTEM BIOSCIENCES, INC. [US]. Inventors: Kevin Chun-Kai Wang [US], Stefanie Morgan [US], Fangting Wu [US], Chiao-Chain Huang [US].

+ Open protocol

+ Expand

WT1 Binding Site Analysis in MMP9 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chromatin immunoprecipitation (ChIP) was performed according to manufacturer's recommendations (Active Motif, Carlsbad, CA). In brief, 10⁶ MHH-ES cells were cross-linked with 1% formaldehyde for 10 min at 37 °C and washed three times with ice-cold PBS, followed by enzymatic shearing of the fixed chromatin per manufacturer's protocol. Next, sheared chromatin was incubated with 2 μg of either anti-WT1 (Novus Biotechnology), anti-RNA pol II, or a negative control IgG (Active Motif). Chromatin bound to the antibody was pulled down with magnetic Protein G-coated beads, washed and eluted. Following crosslink reversal, the purified DNA was subjected to PCR amplification using primers specific for the region containing the putative WT1 binding site in the MMP9 promoter, sense primer: 5’- CTGCGGGTCTGGGGTCTTGC -3; antisense primer: 5’- CGCTCCTGTGACCCCACCCC – 3’ [22 (link)]. PCR fragments were analyzed on 2% agarose 1x TAE gel containing ethidium bromide and the size (196 bp) was compared with a molecular weight marker. These results were further confirmed with quantitative PCR using the same sense and antisense primers.

Katuri V., Gerber S., Qiu X., McCarty G., Goldstein S.D., Hammers H., Montgomery E., Chen A.R, & Loeb D.M. (2014). WT1 regulates angiogenesis in Ewing Sarcoma. Oncotarget, 5(9), 2436-2449.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation qPCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Conventional ChIP-qPCR was performed. Briefly, cells were crosslinked with 1% formaldehyde at room temperature for 10 min followed by glycine quenching, cell lysis, nuclei isolation and lysis and sonication to obtain 150–200 bp DNA fragments. Complexes were immunoprecipitated overnight using 10 μg of anti-HA tag (Cell Signaling 3724), anti-Flag tag (Sigma F1804), anti-H3K4me3 (AbCam ab8580), anti-RNA Pol-II (Active Motif 61083) or anti-DDX5 (Bethyl A300-523A). Real-time qPCR of purified DNA was performed using SYBR Green I MasterMix (Roche 4707516001) on the Light Cycler 480II (Roche). qPCR primers are provided in Supplementary Table 1.

Morgan S.L., Mariano N.C., Bermudez A., Arruda N.L., Wu F., Luo Y., Shankar G., Jia L., Chen H., Hu J.F., Hoffman A.R., Huang C.C., Pitteri S.J, & Wang K.C. (2017). Manipulation of nuclear architecture through CRISPR-mediated chromosomal looping. Nature Communications, 8, 15993.

+ Open protocol

+ Expand

Autophagy Regulation in Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Reagent and antibody sources were as follows: acridine orange, ATRA (all-trans-retinoic acid), bafilomycin A1 (BafA1), BIX01294 trihydrochloride hydrate, DAPI (4′,6-diamidino-2-phenylindole dihydrochloride), laminin, 3-methyladenine (3MA), MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide), anti-LC3 (catalog no. L7543) and anti-β-Actin-peroxidase conjugated antibody (catalog no. A3854) (Sigma-Aldrich, Munich, Germany), anti-ATG5 (catalog no. 2630), anti-ATG7 (catalog no. 2631), anti-cleaved caspase 3 (catalog no. 9661), anti-cleaved caspase 7 (catalog no. 9491), anti-cleaved PARP (poly (ADP-ribose) polymerase-1) (catalog no. 9541), anti-SOX2 (catalog no. 3579) (Cell Signaling Technology, Beverly MA, USA), anti-ULK1 (catalog no. sc-33182) (Santa Cruz Biotechnology, Dallas, Texas, USA), anti-Beclin1 (catalog no. 612112), anti-GFAP (catalog no. 556330) (BD Pharmingen San Jose, CA, USA), anti-H3K4me3 (catalog no. 07-473), anti-H3K27me3 (catalog no. ABE44), anti-OLIG2 (catalog no. AB9610), anti-Tubulin beta III isoform (catalog no. MAB1637) (Millipore, Temecula, CA, USA), anti-H3K9me2 (catalog no. ab1220), anti-G9a (catalog no. ab40542) (Abcam, Cambridge, UK), anti-RNA Pol II (catalog no. 39097) (Active Motif, Carlsbad, CA, USA) and anti-NESTIN (catalog no. MAB1259) (R&D Systems, Minneapolis, MN, USA).

Ciechomska I.A., Przanowski P., Jackl J., Wojtas B, & Kaminska B. (2016). BIX01294, an inhibitor of histone methyltransferase, induces autophagy-dependent differentiation of glioma stem-like cells. Scientific Reports, 6, 38723.

+ Open protocol

+ Expand

Recombinant Nucleosomes with Histone Modifications

Check if the same lab product or an alternative is used in the 5 most similar protocols

Recombinant nucleosomes with modified histones H3K9Ac (cat# 16-0314), H3K9Bu (cat# 16-0371), and H3K18Bu (cat# 16-0373) were purchased from EpiCypher, Inc., and analyzed by Western blotting with the corresponding antibodies.
Cellular protein (25-50 μg) was fractionated using a subcellular protein fractionation kit (Thermo Fisher Scientific, cat# 78,840) according to the manufacturer's protocols. The cellular fractions were separated on a 4%–12% gradient SDS-PAGE (Criterion gels, Bio-Rad) and transferred to nitrocellulose membranes. The antibodies used included anti-H3K9Bu (Abcam, cat# ab241248), anti-H3K18Bu (PTM Bio, cat# PTM-331), anti-H3K9-crotonyl (RevMab, cat# 31-1225,099), anti-H3K27-b-hydroxybutyryl (Abcam, cat# ab241463), anti-H3K9-b-hydroxybutyryl (Thermo Fisher Scientific, PIPA5112503), anti-ACADS (Origene, cat# TA321036), anti-ACAA2 (Origene, cat# TA506126), anti-ACC1/2 (Cell Signaling Technology, cat# 36,765), anti-FASN (Abcam, cat# ab22759), anti-H3 (Active Motif, cat# 61,476), anti-H3K9Ac (Active Motif, cat# 39,917), anti-AKT1 (Millipore 07-416), anti-voltage-dependent anion-selective channel 1 (VDAC1, Genscript, cat# A01419), anti-RNA pol II (Active Motif, cat# 102,660), and anti-turboGFP (Origene, cat# TA150041). Western blotting signals were detected by an Odyssey imaging system (LI-COR) and quantitated using ImageJ.

Yang Z., He M., Austin J., Pfleger J, & Abdellatif M. (2021). Histone H3K9 butyrylation is regulated by dietary fat and stress via an Acyl-CoA dehydrogenase short chain-dependent mechanism. Molecular Metabolism, 53, 101249.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!