Absolute qpcr mix

Total mRNA was isolated with Tri Reagent (MRC Inc.) from upstream or downstream specimens of human carotid plaques. Reverse transcription was performed using the ImProm-II Reverse Transcription System (Promega, Madison, WI) according to the manufacturer's instructions. Real-time PCR (StepOnePlus, Applied Biosystems) was performed with the ABsolute QPCR Mix (ABgene).
Specific primers and probes (Table 3) were used to determine the mRNA expression of RANK, RANKL, OPG, and RPS13 (housekeeping gene). The fold change of mRNA levels was calculated by the comparative C_t method. The measured C_t values were first normalized to the RPS13 internal control, by calculating delta C_t (ΔC_t). This was achieved by subtracting the RPS13 C_t values from the gene of interest C_t value. Delta delta C_t (ΔΔC_t) was calculated by subtracting the designated baseline control group ΔC_t value from the study group ΔC_t values. The ΔΔC_t was then plotted as a relative fold change with the following formula: 2^−ΔΔC_t.

mRNA expression of genes encoding endothelin receptor type A (Ednra) and type B (Ednrb) was analyzed in mouse thoracic aorta by Quantitative Real-Time PCR (qPCR). RNA was isolated using MagNA Pure LC RNA Isolation Kit High Performance (Roche), and reverse transcribed using AMV First Strand cDNA Synthesis Kit for reverse transcription (RT)-PCR (Roche). qPCR was performed on a LightCycler 480 system (Roche) according to the manufacturer’s protocol with reaction mixtures containing 2.5 μl cDNA, 0.4 μmol/L of each primer (Life Technologies), 100 nmol/L UPL probe (Roche) and 10 μl Absolute qPCR mix (Thermo Scientific) in a total volume of 20 μl. Primer (shown in 5′ → 3′orientation)/probes were designed using the Roche Universal Probe Library Assay Design Center:
mEdnra GGGCATCACCGTCTTGAA/GGAAGCCACTGCTCTGTACC, probe UPL#99, mEdnrb TCAGAAAACAGCCTTCATGC/GCGGCAAGCAGAAGTAGAA, probe UPL#83, mHprt TGATAGATCCATTCCTATGACTGTAGA/AAGACATTCTTTCCAGTTAAAGTTGAG, probe UPL#22. QPCR data were analyzed and quantified using the second derivative maximum for Cp determination, with the LightCycler 480 software 1.5.0 (Roche).

PCR-based detection was used to confirm the presence/absence of VIM-1 CPE in enrichment cultures. Real-time PCR was performed on a Bio-Rad CFX system. The bla_VIM primer and probe sequences were adapted from van der Zee et al. (2014) (link) with CAL Flour^® Gold 540 as fluorophore and BHQ-1 as quencher (van der Zee et al., 2014 (link)). Amplification was conducted using ABsolute QPCR Mix, no ROX (Thermo Fisher Scientific) and the following conditions: initially 15 min at 95°C, 30 cycles with 15 s at 95°C and 60 s at 60°C for product amplification.

The copy number of the AVPR2 gene in available healthy females was determined by quantitative real-time PCR on Rotor-Gene Q (Qiagen, Germantown, MD) in a final 25 μl PCR mixture containing 12.5 μl of ABsolute QPCR Mix, no ROX (Thermo Fisher Scientific, Waltham, MA), 1 μl of 10 μM forward primer and 1 μl of 10 μM reverse primer, 1.2 μl 20× EvaGreen Dye (Biotium, Freemont, CA), 2.5 μl of DNA (10 ng/μl) and 6.8 μl H₂O. Primer sequences can be found in Table S1 (Additional file 1). Each sample was tested in three technical replicates with the following conditions: Initial denaturation at 95 °C for 15 min, 40 cycles of 95 °C for 15 s and 60 °C for 60 s and melting curve analysis at 60–90 °C/step 0.5 °C. qPCR data were analysed with double delta Ct analysis, and the copy number of AVPR2 was normalized to the copy number of the GAPDH reference gene in the same sample. The relative copy number of AVPR2 to an unrelated control female were compared and shown in the graph for each sample.

The expression levels of p53 target genes BAX, BBC3, CDKN1A, and GADD45A were studied. First, 500 ng of total RNA isolated from treated and untreated cultivated cells was reverse‐transcribed using Superscript II (ThermoFisher) and oligo(dT)₁₄ primer following the manufacturer's instructions. The level of target mRNA was quantified by real‐time PCR using taqman assays (ThermoFisher), taqman Gene Expression Master Mix (ThermoFisher), and the quantstudio 12 Flex Real‐Time PCR system (ThermoFisher). Assays were carried out in triplicates, and negative controls were included in all PCR series. The ΔΔC_t method was used for the determination of mRNA content. The geometrical mean of house‐keeping genes HPRT1A and TBP cycle threshold (C_t) was used as an internal standard.
For miRNA‐34a expression analysis, 4 ng of total RNA isolated from non‐cultivated untreated cells was reverse‐transcribed using taqman MicroRNA Assays (ThermoFisher) and specific primers for miRNA‐34a and RNU38B following the manufacturer's instructions. Quantification of miRNA was performed by real‐time PCR using taqman assays (ThermoFisher), ABsolute QPCR Mix, ROX (ThermoFisher), and 7500 Fast Real‐Time PCR System (ThermoFisher). All reactions were carried out in triplicates with respective negative controls. The obtained miRNA‐34a expression levels were normalized to RNU38B and interpreted as 2−ΔCt*100%.

The concentration of porcine DNA was determined by qPCR targeting the beta-actin gene on a CFX96 qPCR system (Bio-Rad, Hercules, California, USA). The assay was performed in 20 µL of Absolute qPCR Mix (Thermo Fisher Scientific, Waltham, MA, USA) containing 300 nM forward (Sus_ACTB-F) primer, 300 nM reverse (Sus_ACTB-R) primer, 200 nM 5′-FAM 3′-TAMRA labeled probe (Sus1) [17 (link)] and 1 µL of DNA extract. The amplification parameters were as follows: 95 °C/15 min, followed by 42 cycles of [95 °C/15 s; 60 °C/60 s]. The reference curve was generated using known concentrations of pig genomic DNA (Sigma-Aldrich, Saint Louis, MO, USA).

RNA isolation from cell cultures was performed using the RNeasy Mini kit (Qiagen) following the manufacturer's instructions. cDNA synthesis was done using the SuperScript VILO cDNA Synthesis kit (Thermo Fisher Scientific) following the manufacturer's instructions. Real-time quantitative PCR (RT-qPCR) was performed using ABsolute QPCR Mix with SYBR Green (Thermo Fisher Scientific) and a LightCycler 480 (Roche). The oligos used for RT-qPCR were designed using Primer3 software, and their specificity was verified using BLAST searches against the NCBI database. The oligo sequences used were as follows: ITGA5_for 5’-TGC AGT GTG AGG CTG TGT ACA-3’; ITGA5_rev 5’-GTG GCC ACC TGA CGC TCT-3’; GAPDH_for 5’-CTA TAA ATT GAG CCC GCA GCC-3’; GAPDH-rev 5’-ACC AAA TCC GTT GAC TCC GA-3’.