Log In Sign up
The largest database of trusted experimental protocols

Eagletaq universal master mix

Manufactured by Roche
Visit Supplier
Sourced in Switzerland

The EagleTaq Universal Master Mix is a ready-to-use, high-performance PCR reaction mixture. It contains all the necessary components for efficient and reliable DNA amplification, including DNA polymerase, buffer, and dNTPs.

Automatically generated - may contain errors

Lab products found in correlation

Taqman gene expression assay, by Thermo Fisher Scientific (5 mentions) 18s ribosomal rna, by Thermo Fisher Scientific (4 mentions) Rneasy mini kit, by Qiagen (3 mentions) Steponeplus 96 well real time pcr, by Thermo Fisher Scientific (3 mentions) Trizol reagent, by Thermo Fisher Scientific (3 mentions) Microamp optical 96 well reaction plate, by Thermo Fisher Scientific (3 mentions) Viia7 real time pcr machine, by Thermo Fisher Scientific (3 mentions) Rneasy micro kit, by Qiagen (3 mentions) Trizol, by Thermo Fisher Scientific (3 mentions) Protoscript 2 rt kit, by New England Biolabs (2 mentions) Slc2a1, by Thermo Fisher Scientific (2 mentions) Hif 1α, by Thermo Fisher Scientific (2 mentions) Protoscript 2 rt, by New England Biolabs (2 mentions) High capacity reverse transcription kit, by Thermo Fisher Scientific (2 mentions) Lightcycler 96 system, by Roche (2 mentions) Revertra ace qpcr kit, by Toyobo (2 mentions) 7500 real time pcr system instrument, by Thermo Fisher Scientific (1 mentions) Transcriptor first strand cdna synthesis kit, by Roche (1 mentions) Rnase free dnase set, by Qiagen (1 mentions) E cadherin, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

EagleTaq Master Mix (8 citations) Universal Master mix (7 citations) EagleTaq Universal Master Mix (ROX) (2 citations)

13 protocols using eagletaq universal master mix

1

Quantitative RT-PCR Gene Expression Analysis

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using the RNeasy Mini Kit (Qiagen Inc., Redwood City, CA) with on-column DNase digestion using the RNase-Free DNase Set (Qiagen Inc., Redwood City, CA). Following reverse transcription into cDNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Applied Sciences, Indianapolis, IN), samples were analyzed by real time PCR on a 7500 Real Time PCR System instrument (Applied Biosystems, Inc., Foster City, CA) using EagleTaq Universal Master Mix (Roche Applied Sciences, Indianapolis, IN). Target gene expression was normalized to 18S rRNA expression. The primers and probes used in this study are displayed in S7 Table, or have previously been described [24 (link),62 (link)–65 (link)]. Note that, although there was insufficient mRNA from biopsy samples to perform extensive qRT-PCR validation of gene expression, in contrast to microarray, RNA-Seq has high concordance with qRT-PCR data [28 (link)].
Fletcher S.P., Chin D.J., Gruenbaum L., Bitter H., Rasmussen E., Ravindran P., Swinney D.C., Birzele F., Schmucki R., Lorenz S.H., Kopetzki E., Carter J., Triyatni M., Thampi L.M., Yang J., AlDeghaither D., Murredu M.G., Cote P, & Menne S. (2015). Intrahepatic Transcriptional Signature Associated with Response to Interferon-α Treatment in the Woodchuck Model of Chronic Hepatitis B. PLoS Pathogens, 11(9), e1005103.
+ Open protocol
+ Expand
2

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
1μg of RNA was collected and used for cDNA synthesis (Applied Biosystems, cat#4387406). The qPCR mastermix was made with EagleTaq Universal Mastermix (Roche, cat#07260296190), Taqman probe as specified, and 50ng of cDNA. Probes were as follows: Applied Biosystems; GAPDH (Hs02758991_g1), SPCA2 (Hs00939492_m1), SPCA1 (Hs00995930_m1), E-cadherin (Hs01023894_m1 or HS01023895_m1), N-cadherin (Hs00983056_m1), Zeb1 (Hs00232783_m1), Snail1 (Hs00195591_m1), and Vimentin (Hs00958111_m1).
Dang D.K., Makena M.R., Llongueras J.P., Prasad H., Ko M., Bandral M, & Rao R. (2019). A Ca2+-ATPase Regulates E-cadherin Biogenesis and Epithelial-Mesenchymal Transition in Breast Cancer Cells. Molecular cancer research : MCR, 17(8), 1735-1747.
+ Open protocol
+ Expand
3

Quantitative RT-PCR Analysis of Hypoxia Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cells at indicated time points using TRIzol reagent (Life Technologies). cDNA was generated with ProtoScript II RT Kit (New England BioLabs) and real-time PCR was performed using Eagle Taq Universal Master Mix (Roche) and the Applied Biosystems StepOnePlus™ 96-well Real-Time PCR. Predesigned TaqMan® Assays were purchased from Applied Biosystems: Hif1α (Mm00468869_m1), Slc2a1 (Mm00441473_m1), Hk2 (Mm00443394_m1), Sell (Mm00441291_m1). 18s ribosomal RNA (Life Technologies) was used as an endogenous control.
Xu W., Patel C.H., Zhao L., Sun I.H., Oh M.H., Sun I.M., Helms R.S., Wen J, & Powell J.D. (2023). GOT1 regulates CD8+ effector and memory T cell generation. Cell reports, 42(1), 111987.
+ Open protocol
+ Expand
4

Quantification of Metabolic Regulators in Tregs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tregs were sorted from the spleen and lymph nodes of naïve FoxP3-GFP mice. Total RNA was isolated by using TRIzol reagent (Life Technologies) and following manufacturer’s protocol. RNA (800 ng) was then converted to cDNA with ProtoScript II RT (New England BioLabs). Real-time PCR was performed using EagleTaq Universal Master Mix (Roche). Real-time PCR primers and probes were obtained from Applied Biosystems: Cpt1a (carnitine palmitoyltransferase 1a, liver, Mm01231183_m1), Hif1a (hypoxia inducible factor 1, alpha subunit, Mm00468869_m1), Hk2 (hexokinase 2, Mm00443385_m1), and Pfkp (phosphofructokinase, platelet, Mm00444792_m1). Delta-delta Ct (ΔΔCt) values were normalized to the housekeeping gene 18s ribosomal RNA (Life Technologies) and further normalized to the control group. Experiments were performed on an OneStepPlus 96 well instrument (Applied Biosystems).
Sun I.H., Oh M.H., Zhao L., C.h.i.r.a.g., Patel H., Arwood M.L., Xu W., Tam A.J., Blosser R.L., Wen J, & Powell J.D. (2018). mTORC1 signaling regulates the generation and function of central and effector FoxP3+ regulatory T cells : mTORC1 signaling controls central and effector Tregs. Journal of immunology (Baltimore, Md. : 1950), 201(2), 481-492.
+ Open protocol
+ Expand
5

RNA Extraction, Reverse Transcription, and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from TECs after digestion and CD45 cell-depletion using the RNeasy Micro kit (QIAGEN, Hilden, Germany). Reverse transcription of mRNA was performed with the High Capacity Reverse Trancription Kit (Applied Biosystems, Foster City, CA, USA). Real-time PCR was performed using TaqMan Gene expression Assays (Applied Biosystems) and the EagleTaq Universal Master Mix (Roche, Basel, Switzerland). PCR reactions were performed in MicroAmp®Optical 96-well reaction plates (Applied Biosystems) in a final volume of 25 μl and run on the Viia-7 Real-Time PCR machine (Applied Biosystems). Relative quantification of genes was performed with the 2−ΔΔCt method and expressed as fold change relative to the expression of the endogenous control, RPLPO.
Marcovecchio G.E., Bortolomai I., Ferrua F., Fontana E., Imberti L., Conforti E., Amodio D., Bergante S., Macchiarulo G., D'Oria V., Conti F., Di Cesare S., Fousteri G., Carotti A., Giamberti A., Poliani P.L., Notarangelo L.D., Cancrini C., Villa A, & Bosticardo M. (2019). Thymic Epithelium Abnormalities in DiGeorge and Down Syndrome Patients Contribute to Dysregulation in T Cell Development. Frontiers in Immunology, 10, 447.
+ Open protocol
+ Expand
6

Real-Time PCR Analysis of Renal Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from kidney tissues using an RNeasy Mini Kit (Qiagen). RT of 1 μg of total RNA was performed using Takara PrimeScript RT Master Mix (Takara Bio Inc.). mRNA expression was measured by real-time PCR using a TaqMan gene expression assays (Thermo Fisher Scientific). Primers for mouse Rhcg mRNA (Mm00451199_m1), rat Rhcg (Rn00788284_m1), and mouse and rat GAPDH (Mm99999915_g1) were from Thermo Fisher Scientific. Primers for rat Sgk1 (NM_019232) were designed (sense: CAACCTGGGTCCATCCTCAAA; anti-sense: GTTTTGGAAAGGTTCTTCTAGCAAG; probe: CCCACGCCAAACCCTCTGACTTCCAC) and purchased from Sigma-Aldrich Japan. Real-time PCR was performed in a LightCycler 480 system (Roche Life Science). EagleTaq Universal Master Mix (Roche Life Science) was used for amplification. Ct values from Rhcg or Sgk1 were normalized by the subtraction of the Ct values of Gapdh. The ΔCt was calculated by the subtraction of Ct for mice or cells with vehicle from that for mice or cells treated, and was then applied to the 2-ΔCt equation. Fold difference was determined relative to vehicle.
Eguchi K., Izumi Y., Yasuoka Y., Nakagawa T., Ono M., Maruyama K., Matsuo N., Hiramatsu A., Inoue H., Nakayama Y., Nonoguchi H., Lee H.W., Weiner I.D., Kakizoe Y., Kuwabara T, & Mukoyama M. (2021). Regulation of Rhcg, an ammonia transporter, by aldosterone in the kidney. The Journal of endocrinology, 249(2), 95-112.
+ Open protocol
+ Expand
7

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from TECs after digestion and CD45 cell-depletion, from thymocytes and PBMCS using the RNeasy Micro kit (QIAGEN, Hilden, Germany). Reverse transcription of mRNA was performed with the High Capacity Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Real-time PCR was performed using TaqMan Gene expression Assays (Applied Biosystems) and the EagleTaq Universal Master Mix (Roche, Basel, Switzerland). PCR reactions were performed in MicroAmp®Optical 96-well reaction plates (Applied Biosystems) in a final volume of 25 μl and run on the Viia-7 Real-Time PCR machine (Applied Biosystems). Relative quantification of genes was performed with the 2−ΔΔCt method and expressed as fold change relative to the expression of the endogenous control, RPLP0.
Marcovecchio G.E., Ferrua F., Fontana E., Beretta S., Genua M., Bortolomai I., Conti A., Montin D., Cascarano M.T., Bergante S., D’Oria V., Giamberti A., Amodio D., Cancrini C., Carotti A., Di Micco R., Merelli I., Bosticardo M, & Villa A. (2021). Premature Senescence and Increased Oxidative Stress in the Thymus of Down Syndrome Patients. Frontiers in Immunology, 12, 669893.
+ Open protocol
+ Expand
8

Gata6 expression in IL-4-stimulated peritoneal cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Attached peritoneal exudate cells (0.5 × 106) were incubated with/without recombinant IL-4 (10ng/mL) or with/without 1μM FOXO inhibitor AS184285 (Calbiochem) and collected at indicated time points. Total RNA was extracted with Trizol (Life Technologies) and was converted to cDNA using the ProtoScript II RT (New England BioLabs). Predesigned TaqMan® Assays were purchased from Applied Biosystems: Gata6 (Mm00802636_m1). qPCR was performed using Eagle Taq Universal Master Mix (Roche) and Applied Biosystems StepOnePlus 96-well Real-Time PCR. Ct values were normalized to 18S ribosomal RNA (Life Technologies) and relative quantification of gene expression ratio was shown in comparison to control.
Oh M.H., Collins S.L., Sun I.H., Tam A.J., Patel C.H., Arwood M.L., Chan-Li Y., Powell J.D, & Horton M.R. (2017). mTORC2 signaling selectively regulates generation and function of tissue-resident peritoneal macrophages. Cell reports, 20(10), 2439-2454.
+ Open protocol
+ Expand
9

RNA Extraction and RT-qPCR Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Samples were treated with TRIzol (Thermo Fisher Scientific). RNA extracts were digested with DNase I (Promega, Fitchburg, WI, USA) and purified using the RNeasy Mini Kit (Qiagen, Venlo, Netherlands). Total RNA samples were treated with a Revertra Ace qPCR kit (Toyobo, Osaka, Japan) to obtain cDNA. cDNA samples were mixed with EagleTaq Universal Master Mix (Roche, Basel, Switzerland) and target-specific TaqMan probes (Thermo Fisher Scientific; Supplementary Tables 4 and 5). RT-qPCR was performed using a Light Cycler 96 system (Roche) under the following conditions: 50 °C for 120 s; 95 °C for 600 s; 45 cycles of 95 °C for 15 s and 60 °C for 60 s. Glyceraldehyde 3-phosphate dehydrogenase mRNA (mouse samples) and 18S ribosomal RNA (human samples) were used for data normalization.
Yoshimaru K., Yamaza T., Kajioka S., Sonoda S., Yanagi Y., Matsuura T., Yoshizumi J., Oda Y., Iwata N., Takai C., Nakayama S, & Taguchi T. (2022). Dental pulp stem cells as a therapy for congenital entero-neuropathy. Scientific Reports, 12, 6990.
+ Open protocol
+ Expand
10

Quantitative RT-PCR Analysis of Hypoxia Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cells at indicated time points using TRIzol reagent (Life Technologies). cDNA was generated with ProtoScript II RT Kit (New England BioLabs) and real-time PCR was performed using Eagle Taq Universal Master Mix (Roche) and the Applied Biosystems StepOnePlus™ 96-well Real-Time PCR. Predesigned TaqMan® Assays were purchased from Applied Biosystems: Hif1α (Mm00468869_m1), Slc2a1 (Mm00441473_m1), Hk2 (Mm00443394_m1), Sell (Mm00441291_m1). 18s ribosomal RNA (Life Technologies) was used as an endogenous control.
Xu W., Patel C.H., Zhao L., Sun I.H., Oh M.H., Sun I.M., Helms R.S., Wen J, & Powell J.D. (2023). GOT1 regulates CD8+ effector and memory T cell generation. Cell reports, 42(1), 111987.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!