Abi prism 7700 system

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany

The ABI PRISM 7700 system is a real-time PCR instrument designed for nucleic acid detection and quantification. It utilizes fluorescence-based detection technology to provide accurate and sensitive measurement of target sequences.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

ABI Prism 7700 sequencing detection system ABI PRISM 7700 detection system ABI PRISM 7700 Sequence Detection System and software ABI Prism 7700 Sequence Detection System 14 ABI/Prism 7700 Sequence Detector System ABI PRISM 7700 DNA Sequence Detection System ABI Prism 7700 Real-Time PCR system ABI Prism 7700 Sequence Detection System software ABI Prism 7700 Sequence Detection System User Bulletin #2 ABI Prism 7700 Sequence Detector System

59 protocols using abi prism 7700 system

Urine RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

First morning urine samples obtained at the time of kidney biopsy were centrifuged at 3,000 × g for 20 min at 4 °C within 2 h after sample collection. Then, the obtained urinary sediments were resuspended in 1.5 ml DEPC-treated PBS and centrifuged at 12,000 × g for 5 min at 4 °C. One millilitre of RNAiso Plus (Takara, Life Technologies) was added to preserve total RNA, and the samples were stored at −80 °C until use. Total RNA was extracted according to the manufacturer’s protocol (Ambion, Life Technologies). We measured the RNA concentrations using a NanoDrop 2000 (Thermo) based on the relative absorbance ratio at 260/280, and the RNA purity was also assessed by agarose gel electrophoresis. The qualified RNA samples were stored at −80 °C until use.
We used the kit from Invitrogen to reverse transcribe the total RNA (Invitrogen, Life Technologies), which was stored at −20 °C until use. mRNA-expression levels were quantified by real-time quantitative polymerase-chain-reaction (qPCR) assays in an ABI PRISM7700 system (Applied Biosystems). The thermocycling conditions were set as follows: 95 °C for 10 min, followed by 40 cycles of 15 s at 95 °C and 60 °C for 1 min. Dissociation curves and melting temperatures were recorded and relative mRNA expression levels were calculated by the ΔΔCt method27 (link).

Zhou L.T., Cao Y.H., Lv L.L., Ma K.L., Chen P.S., Ni H.F., Lei X.D, & Liu B.C. (2017). Feature selection and classification of urinary mRNA microarray data by iterative random forest to diagnose renal fibrosis: a two-stage study. Scientific Reports, 7, 39832.

+ Open protocol

+ Expand

Tissue-specific Expression Analysis of OsABCG18

Check if the same lab product or an alternative is used in the 5 most similar protocols

Various tissues including roots, stems, and young and mature leaves were harvested at the booting stage (~70 DAG) for RNA extraction. Young panicles and filling stage panicles of 12 cm and 18 cm in length, respectively, were harvested for RNA extraction. Total RNA was prepared using the TRIzol reagent (Invitrogen). cDNA was synthesized using HiScript QRTsupermix for qPCR (+gDNA wiper) (R123-01,Vazyme, China). qRT-PCR was performed using SYBR Green (TaKaRa) on an ABI PRISM 7700 system (Applied Biosystems, USA) according to the manufacturer’s instructions. For qRT-PCR, the OsABCG18 primers ABCG18-P5/-P6 were used, and the ubiquitin (UBQ) gene amplified with UBQ-F/-R was used for quantitative normalization.

Zhao J., Yu N., Ju M., Fan B., Zhang Y., Zhu E., Zhang M, & Zhang K. (2019). ABC transporter OsABCG18 controls the shootward transport of cytokinins and grain yield in rice. Journal of Experimental Botany, 70(21), 6277-6291.

+ Open protocol

+ Expand

RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from liver tissue using the Quick RNA mini prep kit (Zymo Research Corp., Irvine, CA, USA) and was reverse-transcribed into cDNA. RT-qPCR analysis was performed with 50 ng of cDNA template and specific primers using a SYBR-Green PCR kit (5 µl; Power SYBR^®-Green PCR Master mix) and an ABI Prism 7700 system (Applied Biosystems^®; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. The thermocycling conditions were as follows: UDG activation, 50°C for 2 min (1 cycle); Dual-lock DNA polymerase, 95°C for 2 min (1 cycle); denaturation, 95°C for 15 sec (40 cycles); annealing, 60°C for 1 min (40 cycles) and extension, 72°C for 10 min (1 cycle). The RT-qPCR primers (400 nM) for each gene are listed in Table SI. Target mRNA expression in each sample was normalized to the housekeeping gene GAPDH. The 2^−ΔΔCq method was used to calculate relative mRNA expression levels (28 (link)).

Dong B., Singh A.B., Guo G.L., Young M, & Liu J. (2019). Activation of FXR by obeticholic acid induces hepatic gene expression of SR-BI through a novel mechanism of transcriptional synergy with the nuclear receptor LXR. International Journal of Molecular Medicine, 43(5), 1927-1938.

+ Open protocol

+ Expand

Cardiac Gene Expression Profiling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time PCR was performed as previously described [11 (link)]. Total RNA was extracted from cardiac tissue (peri-infarction area, ventricular septum, and remote area) and reverse transcribed using TaqMan reverse transcription reagents (Applied Biosystems, Stockholm, Sweden). RT-PCR was performed on an ABI PRISM 7700 system (Applied Biosystems) using rat-specific primers for VEGF-A, transforming growth factor-β (TGFβ), interleukin (IL)-1β, and IL-6 (Assay ID: Rn01511601_m1, Rn00572010_m1, Rn00580432_m1, and Rn01410330_m1, respectively) in the first examination; for SDF1 (Assay ID: Rn00573260_m1) in the second examination; and for GFP (Assay ID: Mr04097229_mr) in the third examination. Each cDNA sample was evaluated in duplicate. Expression of target genes was normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for each sample. Relative gene expression was determined using the 2^−ΔΔC_T method.

Goto T., Miyagawa S., Tamai K., Matsuura R., Kido T., Kuratani T., Shimamura K., Sakaniwa R., Harada A, & Sawa Y. (2020). High-mobility group box 1 fragment suppresses adverse post-infarction remodeling by recruiting PDGFRα-positive bone marrow cells. PLoS ONE, 15(4), e0230392.

+ Open protocol

+ Expand

Genotyping of AMD-Associated SNPs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotyping was performed in 92 patients. Genomic DNA was prepared from leukocytes of peripheral blood using a DNA extraction kit (QuickGene-610L; Fujifilm, Tokyo, Japan). We genotyped the major AMD-associated single nucleotide polymorphisms, i.e., ARMS2 A69S rs10490924, CFH I62V rs800292, and CFH Y402H rs1061170, using TaqMan ANP assays with the ABI PRISM 7700 system (Applied Biosystems Inc, Foster City, CA). I

Tagawa M., Ooto S., Yamashiro K., Tamura H., Oishi A., Miyata M., Hata M., Yoshikawa M., Yoshimura N, & Tsujikawa A. (2020). Characteristics of pachychoroid neovasculopathy. Scientific Reports, 10, 16248.

+ Open protocol

+ Expand

Genotyping and Genome-wide Imputation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotyping was performed with all patients. Genomic DNA was prepared from leukocytes of peripheral blood with a QuickGene-610L DNA extraction kit (Fujifilm, Tokyo, Japan). During the discovery stage, genome-wide genotyping was performed using the HumanOmni2.5–8 BeadChip Kit (Illumina Inc., San Diego, CA). To ensure high-quality genotype data, a series of quality control filters were applied to the raw data, including a MAF cutoff of >0.01 and genotyping success rate of >95%. Genome-wide imputation was performed using the Michigan Imputation Server (https://imputationserver.sph.umich.edu/index.html) with ASN population haplotypes from the 1000 Genomes project (phase 3) as reference sequences. Series of quality-control filters were applied again to the post-imputed dataset, including a MAF cutoff of >0.01, a genotyping success rate of >90%, and an individual call rate of >90%. Quality control was performed using PLINK (version 1.07; http://pngu.mgh.harvard.edu/~purcell/plink; accessed April 11, 2015). During the replication stage, samples were genotyped using TaqMan SNP assays with the ABI PRISM 7700 system (Applied Biosystems Inc., Foster City, CA). We did not consider deviations in genotype distributions from the Hardy–Weinberg equilibrium because all samples were from patients with AMD.

Yamashiro K., Mori K., Honda S., Kano M., Yanagi Y., Obana A., Sakurada Y., Sato T., Nagai Y., Hikichi T., Kataoka Y., Hara C., Koyama Y., Koizumi H., Yoshikawa M., Miyake M., Nakata I., Tsuchihashi T., Horie-Inoue K., Matsumiya W., Ogasawara M., Obata R., Yoneyama S., Matsumoto H., Ohnaka M., Kitamei H., Sayanagi K., Ooto S., Tamura H., Oishi A., Kabasawa S., Ueyama K., Miki A., Kondo N., Bessho H., Saito M., Takahashi H., Tan X., Azuma K., Kikushima W., Mukai R., Ohira A., Gomi F., Miyata K., Takahashi K., Kishi S., Iijima H., Sekiryu T., Iida T., Awata T., Inoue S., Yamada R., Matsuda F., Tsujikawa A., Negi A., Yoneya S., Iwata T, & Yoshimura N. (2017). A prospective multicenter study on genome wide associations to ranibizumab treatment outcome for age-related macular degeneration. Scientific Reports, 7, 9196.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gonad mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from gonads dissected from one day-old (after the L4-to-adult molt) animals. cDNA was synthesized with oligo(dT) primers using the ImProm II Reverse transcription system from Promega according to manufacturer's instructions. cDNA was used for qPCR with the Absolute QPCR SYBR green ROX mix (AbGene) on an ABI PRISM 7700 system (Applied Biosystems). qPCR reactions were performed as previously described [31] (link). At least one primer in each pair is specific for an exon-exon junction. Human carrier RNA was added to each sample before RNA extraction, allowing normalization to hGAPDH. Standard curves for quantification were generated from a serial dilution of input cDNA for each primer pair. The amount of target present in each replicate was derived from a standard curve; an average was calculated for the triplicates. To compare total mRNA levels, the qPCR results were normalized to human GAPDH and to the wild-type values for each primer pair and fold enrichments were calculated. For primers used, see Text S1.

Tocchini C., Keusch J.J., Miller S.B., Finger S., Gut H., Stadler M.B, & Ciosk R. (2014). The TRIM-NHL Protein LIN-41 Controls the Onset of Developmental Plasticity in Caenorhabditis elegans. PLoS Genetics, 10(8), e1004533.

+ Open protocol

+ Expand

RT-qPCR analysis of lncRNA and miRNA expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRIzol reagent (Invitrogen) was adopted to extract RNAs from indicated cells were prepared following the manufacturers’ protocol. The RNA quality was determined via a NanoDrop 2000 instrument (Thermo Scientific, USA), and 5 μg RNA was used as template to synthesis cDNA using a High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, USA). SYBR Premix Ex Taq Kit (Takara, Tokyo) was adopted to conduct qRT-PCR on an ABI Prism 7700 system (PE Applied Biosystems, USA). Fold changes in RNA relative expression was counted through the 2^–ΔΔCt method. Primers were summarized as follows:

SNHG14: forward, 5′-GGGTGTTTACGTAGACCAGAACC-3′; reverse, 5′-CTTCCAAAAGCCTTCTGCCTTAG-3′

miR-133a: forward, 5′-CTGCAGCTGGAGAGTGTGCG-3′; reverse, 5′-GTGCTCTGGAGGCTAGAGGT-3′

HOXB13: forward, 5′-ATGGAGCCCGGCAATTATGCCACC-3′; reverse, 5′-TTAAGGGGTAGCGCTGTTCTT-3′

GAPDH: forward, 5′-GGCGTTCTCTTTGGAAAGGTGTTC-3′; reverse, 5′- GTACTCAGCGGCCAGCATCG -3′

U6: forward 5′-CTC GCT TCG GCA GCA CA-3′, reverse 5′-AAC GCT TCA CGA ATT TGC GT-3′

Xu L., Xu Y., Yang M., Li J., Xu F, & Chen B.L. (2020). LncRNA SNHG14 regulates the DDP-resistance of non-small cell lung cancer cell through miR-133a/HOXB13 pathway. BMC Pulmonary Medicine, 20, 266.

+ Open protocol

+ Expand

Quantification of Cytokine and Chemokine mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative real-time PCR was performed to measure the relative levels of cytokine and chemokine transcripts. Total RNA was extracted using the TRI Reagent (Molecular Research Center Inc., Cincinnati, OH) and reverse-transcribed into cDNA using Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA) and gene-specific primers (Table I). Quantitative real-time PCR was performed using the ABI prism 7700 system (PE Applied Biosystems, Foster city, CA). Finally, the measured expression levels were normalized to 18S rRNA and expressed as fold changes of the untreated controls.

Mishra A., Guo Y., Zhang L., More S., Weng T., Chintagari N.R., Huang C., Liang Y., Pushparaj S., Gou D., Breshears M, & Liu L. (2016). A Critical Role for P2X7 Receptor-Induced VCAM-1 Shedding and Neutrophil Infiltration during Acute Lung Injury. Journal of immunology (Baltimore, Md. : 1950), 197(7), 2828-2837.

+ Open protocol

+ Expand

Quantitative gene expression analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using a TaKaRa minibest universal RNA extraction kit, and cDNAs were synthesized using HiScript Q RT supermix for quantitative qPCR (+ gDNA wiper; R123-01; Vazyme). qPCR was performed using Accupower Super qPCR kit (APS01; SibEnzyme) on an ABIPRISM7700 system (Applied Biosystems, USA). ACTIN2 was used as an internal control in the analysis of the qRT-PCR data from whole leaves. The qPCR primers included S3H-qPCR-F (5′-TTCATCGTCAATATCGGCGAC-3′) and S3H-qPCR-R (5′-ATCGATAACCGCTCGTTCTCG-3′) for S3H, PR1-qPCR-F (5′-CGAAAGCTCAAGATAGCCCACA-3′) and PR1-qPCR-R (5′-TTCTGCGTAGCTCCGAGCATAG-3′) for PR1, PR2-qPCR-F (5′-GCTTCCTTCTTCAACCACACAGC-3′) and PR2-qPCR-R (5′-CGTTGATGTACCGGAATCTGAC-3′) for PR2, ACTIN2-qPCR-F (5′-GGTAACATTGTGCTCAGTGGTGG-3′) and ACTIN2-qPCR-R (5′-CTCGGCCTTGGAGATCCACATC-3′) for ACTIN2.

Cai Z., Guo H., Shen S., Yu Q., Wang J., Zhu E., Zhang P., Song L., Zhang Y, & Zhang K. (2022). Generation of the salicylic acid deficient Arabidopsis via a synthetic salicylic acid hydroxylase expression cassette. Plant Methods, 18, 89.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!