Total RNA was extracted from EC patients’ tumors and adjacent tissues obtained from Hebei General Hospital using RNAiso Plus total RNA extraction reagent (Takara, Japan). cDNA was synthesized using a PrimeScript RT reagent Kit with gDNA Eraser (Takara, Japan). The reaction conditions were as follows: 37 °C for 15 min, 85 °C for 5 s and 4 °C for termination. The real-time PCR was performed on the Bio-Rad CFX 96 Real-time PCR system (BIO-RAD, USA) using SYBR Premix Ex Taq Real-Time PCR Kit (Takara, Japan) and specific primers (Z94721.1, Forward: CCAAAACAACACTGCCCGAG, Reverse: GCTGACCGATTGACCAGACA; AL035461.2, Forward: AGGTGACTCGCTGCATCATT, Reverse: CCGTGTGGGACACTTACTCG; AC051619.4, Forward: GACACTTCTGGTTGGGGCAT, Reverse: CAACTCTCATGTGCAGGGCA). The reaction conditions were one cycle of initial denaturation at 95 °C for 3 min, followed by 35 cycles of 95 °C for 30 s, 60 °C for 30 s. The 2−ΔΔCq method was used to calculate gene expression. The differences were tested by Two-Sample t-Test.
Sybr premix extaq real time pcr kit
Manufactured by Takara Bio
Sourced in Japan, United States
The SYBR Premix ExTaq real-time PCR Kit is a reagent for real-time PCR analysis. It contains SYBR Green I dye and ExTaq DNA polymerase for the detection and quantification of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (10 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (7 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Primescript rt reagent kit, by Takara Bio (4 mentions)
Rnaiso plus total rna extraction reagent, by Takara Bio (3 mentions)
Cfx96 real time pcr system, by Bio-Rad (2 mentions)
Rt reagent kit rr047a, by Takara Bio (2 mentions)
Cdna synthesis kit, by Takara Bio (2 mentions)
Nanodrop one microvolume uv vis spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Primerscript rt kit, by Takara Bio (2 mentions)
Invitrogen trizol kit, by Thermo Fisher Scientific (2 mentions)
Revertra ace qpcr rt kit, by Toyobo (2 mentions)
Abi 7500 thermocycler, by Thermo Fisher Scientific (1 mentions)
Trizol solution, by Thermo Fisher Scientific (1 mentions)
Primescipt rt reagent kit, by Takara Bio (1 mentions)
Protease inhibitor cocktail 100, by Thermo Fisher Scientific (1 mentions)
Ripa lysis buffer, by Beyotime (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Immobilon western chemiluminescent hrp substrate ecl, by Merck Group (1 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (1 mentions)
27 protocols using sybr premix extaq real time pcr kit
1
Quantitative Analysis of RNA Levels
2
Quantification of HIF-1α and Survivin Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Subsequently, RNA was reverse transcribed into cDNA using a RT kit (cat. no. D7168L; Beyotime Institute of Biotechnology), according to the manufacturer's protocol. qPCR analysis was performed using SYBR Premix Ex Taq™ Real-Time PCR kit (Takara Bio, Inc.) on an ABI 7500 Thermocycler (Applied Biosystems; Thermo Fisher Scientific, Inc.). The PCR thermocycling conditions were as follows: 4 min pretreatment at 94°C, followed by 30 cycles at 94°C for 30 sec and 65°C for 30 sec, and a final extension step at 72°C for 10 min; the samples were then maintained at 4°C. The primers were designed by Invitrogen; Thermo Fisher Scientific, Inc., as follows: HIF-1α, forward 5′-CAGTCGACACAGCCTGGATA-3′, reverse 5′-CCACCTCTTTTGGCAAGCAT-3′ (product: 210 bp); survivin, forward 5′-TAGCTGCACACCTGACAAGA-3′, reverse 5′-CCGTCAGCTCAGTGAAGTCT-3′ (product: 200 bp); and GAPDH, forward 5′-CCATCTTCCAGGAGCGAGAT-3′ and reverse 5′-TGCTGATGATCTTGAGGCTG-3′ (product: 222 bp). GAPDH was used as a control of the input RNA level. Gene expression was quantified using the 2−ΔΔCq method (26 (link)).
3
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNAs were extracted using TRIzol solution (Invitrogen). cDNA synthesis was implemented using a Primescipt RT reagent kit (TaKaRa, Dalian, China). qRT-PCR was performed using an SYBR Premix ExTaq Real‐Time PCR Kit (TaKaRa). GAPDH was used as the internal reference, and data were calculated using the 2−ΔΔCT method. Specific primer sequences are shown as following: LINC01315 (forward) 5′-CTGCTGAGCGATGAAGTGGA-3′ and (reverse) 5′-CTACAGCTGGAGGGAAACCG-3′; β-catenin (forward) 5′-ATGGACGTGGGCGAACTTC-3′ and (reverse) 5′-TTTGTTTCCGACGCATCTTCT-3′; C-myc (forward) 5′-AGGGATCGCGCTGAGTATAA-3′ and (reverse) 5′-TGCCTCTCGCTGGAATTACT-3′; Cyclin D1 (forward) 5′-GCTGCGAAGTGGAAACCATC-3′ and (reverse) 5′-CCTCCTTCTGCACACATTTGAA-3′; GAPDH (forward) 5′-TGTGGGCATCAATGGATTTGG-3′ and (reverse) 5′-ACACCATGTATTCCGGGTCAAT-3′.
4
Quantifying lncRNA Expression from Bone Marrow
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from bone marrow and cell samples using an Invitrogen™ TRIZOL according to the manufacturer’s instructions. All RNA samples were stored at –80 °C before reverse transcription and quantitative RT-PCR. RNA was reverse transcribed into cDNA with the PrimeScript® RT reagent Kit with Gdna Eraser (Takara, Japan). Quantitative RT-PCR was performed using the SYBR Premix ExTaq real-time PCR Kit (Takara, Japan) according to the manufacturer’s instructions. Data were normalized to GAPDH expression as a control. The relative expression level for LNC-SNO49AB and other lncRNA or mRNA was determined using the 2−ΔΔCt method. The primers are listed in Supplementary Table S6 .
5
RNA Extraction and Real-Time PCR Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer’s instructions. RNA was reverse transcribed into cDNA using the RT reagent Kit RR047A (Takara, Shiga, Japan) and followed by real-time PCR with a SYBR Premix ExTaq Real-time PCR Kit (Takara). All gene expression levels were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Oligonucleotide sequences are listed in Supplementary Table S2
6
Molecular Signaling Pathway Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
KR-12 (KRIVQRIKDFLR) was synthesized and purified by GL Biochemistry (Shanghai). Alizarin Red dye solution was purchased from Servicebio (Wuhan, China). Phosphatase (ALP) Color Development Kit, ALP Quantitative Kit, RIPA lysis buffer, and phenylmethylsulfonyl fluoride (PMSF; 100×) were purchased from Beyotime Biotechnology (Nantong, China). TRIzol reagent was purchased from Invitrogen (Carlsbad, CA, USA). The SYBR Premix EX Taq Real-time PCR kit and cDNA Synthesis Kit were purchased from TaKaRa (Japan). Protease inhibitor cocktail (100×) and the BCA Protein Assay Kit were purchased from Thermo Fisher (USA). Polyvinylidene fluoride membrane for western blotting and Immobilon western Chemiluminescent HRP Substrate (ECL) were purchased from Millipore (USA). Monoclonal antibodies against SMAD1 (D59D7), SMAD5 (D4G2), SMAD4 (D3M6U), P-SMAD1/5 (41D10), GAPDH (D16H11), and horseradish peroxidase-linked anti-IgG secondary antibodies were purchased from Cell Signaling Technology (USA). TGF-β/SMAD inhibitor (LDN-193189 HCL) was purchased from Selleck Chemicals (Houston, TX, USA). Lipofectamine™ 3000 and Lipofectamine™ RNAiMAX transfection reagent were purchased from Invitrogen (Carlsbad, CA, USA). Gaussia luciferase reporter plasmids and Secrete-Pair Assay Kit were purchased from Genecopoeia (Rockville, MD, USA).
7
Comprehensive RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the cells and tissues using an RNA extraction kit (Takara, Beijing, China). cDNA was synthesized using a ABScript II cDNA First Strand Synthesis kit (ABclonal, Wuhan, China). The reaction conditions were set at 85°C for 15 min. Subsequently, cDNA was amplified using the TeloPrime Full-Length cDNA Amplification kit (Lexogen, Beijing, China). qPCR experiments were performed using a SYBR Premix Ex Taq™ Real-Time PCR Kit (Takara Bio, Inc., Otsu, Japan). The reaction conditions were set at 90°C for 20 sec, (at 90°C for 10 sec and at 58°C for 40 sec) for 35 cycles, at 72°C for 3 min. The sequences of the primers used are listed in Table I . U6 and GAPDH were used as internal controls. Gene expression was quantified using the 2-ΔΔCq method (33 (link)).
8
RT-qPCR Analysis of mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR was performed to detect the mRNA levels. The cells were triturated and lysed using TRIzol reagent (Thermo Fisher Scientific, Inc.) at 0°C for 5 min, and the RNAs were extracted by CHCl3 (Shanghai Aladdin Technology Co., Ltd., Shanghai, China). Next, the RNA concentration was measured by a UV spectrophotometer (NanoDrop One Microvolume UV-Vis spectrophotometer; Thermo Fisher Scientific, Inc.). RT assays were performed on RNA samples using an RT kit (Takara Bio, Inc.) to synthesize cDNA. The RT reaction conditions were set to 37°C for 15 min, and reverse transcriptase inactivation was conducted at 85°C for 15 sec. Subsequently, qPCR experiments were performed with the SYBR Premix Ex Taq™ Real-Time PCR kit (Takara Bio, Inc.). qPCR was performed by activating the DNA polymerase at 95°C for 5 min, followed by 40 cycles of two-step PCR (at 95°C for 10 sec and 60°C for 30 sec) and a final extension at 75°C for 10 min, held at 4°C. DNase and RNase-free water were used as the templates of negative control experiments. All primers were obtained from Genewiz (Suzhou, China) and are listed in Table I . GAPDH was used as an internal control. The formula 2−ΔΔCq (13 (link)) was implemented to analyze and quantify the gene expression.
9
Quantitative Analysis of mRNA and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from tissues and cell lines with TRIzol (Invitrogen) according to the user manual. For mRNA expression analysis, 1 μg of total RNA was used for RT using PrimerScriptTM RT Kit following the manufacturers protocol (TaKaRa), and real-time PCR was performed using SYBR® Premix Ex Taq™ Real Time PCR Kit (TaKaRa) on an Mx3000P Stratagene. All data were normalized to GAPDH expression and further normalized to the negative control unless otherwise indicated. Primer sequences for TGFβR2 (forward: 5′-AAGATGACCGCTCTGACATCA-3′, reverse: 5′-CTTATAGACCTCAGCGAC-3′) and GAPDH (forward: 5′-CCATGAGAAGTATGACAAC AGCC-3′, reverse: 5′-GGGTGCTAAGCAG TTGGTG-3′) were acquired from Primer-bank (http://pga.mgh.harvard.edu/primerbank/ ). For miRNA expression analysis, mature miRNAs were reverse-transcribed for subsequent real-time PCR using All-in-One™ miRNA qRT-PCR Detection Kit following the manufacturer’s protocol (GeneCopoeia). All data were normalized to U6 expression. The fold changes were calculated by relative quantification (2-∆∆Ct). QRT-PCR was conducted for each sample in triplicate.
10
Comprehensive lncRNA and mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction of total RNA was exerted using TRIzol reagent (Thermo, USA) in accordance with the manufacturer’s protocol. All RNA samples were kept at −80 °C until reverse transcription and qRT-PCR. Using the PrimeScript® RT Reagent Kit (Takara, Japan), cDNA was obtained by RNA reverse transcription. Random hexamers or oligo(dT)18 primers (Qiagen) were used for reverse transcription. According to the manufacturer’s protocol, SYBR Premix ExTaq real-time PCR Kit (Takara, Japan) was used to perform qRT-PCR. Normalization was performed using ACTIN and GAPDH as internal reference controls. 2-ΔΔCt was utilized to count the expression levels of lncRNA and mRNA. Supplementary Table 2 list all the primers information.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!