Log In Sign up
The largest database of trusted experimental protocols

Ab quantstudio 7 flex

Manufactured by Thermo Fisher Scientific
Visit Supplier

The AB-QuantStudio 7 Flex is a real-time PCR system designed for quantitative gene expression analysis. It features a compact design, a 96-well block, and a multi-color detection system to enable diverse experimental applications.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy kit, by Qiagen (2 mentions) Taqman universal pcr master mix, by Thermo Fisher Scientific (2 mentions)

Spelling variants of this product

QuantStudio 7 Flex (372 citations) QuantStudio 7 (209 citations)

3 protocols using ab quantstudio 7 flex

1

Quantifying Mitochondrial DNA Abundance

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mitochondrial DNA present per nuclear genome was determined using the following primer pairs: mitochondrial Nd2: fw: 5′- AGGGATCCCACTGCACATAG-3′; rev: 5′- CTCCTCATGCCCCTATGAAA-3′; mitochondrial D-Loop: fw: 5′- GGTTCTTACTTCAGGGCCATCA-3′, rev: 5′-GATTAGACCCGATACCATCGAGAT-3′; nuclear Nduv: fw: 5′- CTTCCCCACTGGCCTCAAG-3′; rev: 5′- CCAAAACCCAGTGATCCAGC-3′. Relative mitochondrial DNA content was calculated relative to nuclear DNA content based on the 2 × 2ΔCT method (Rooney et al., 2015 (link)). Quantitative PCR was performed on an AB-QuantStudio 7 Flex (Applied Biosystems).
Timper K., del Río-Martín A., Cremer A.L., Bremser S., Alber J., Giavalisco P., Varela L., Heilinger C., Nolte H., Trifunovic A., Horvath T.L., Kloppenburg P., Backes H, & Brüning J.C. (2020). GLP-1 Receptor Signaling in Astrocytes Regulates Fatty Acid Oxidation, Mitochondrial Integrity, and Function. Cell Metabolism, 31(6), 1189-1205.e13.
+ Open protocol
+ Expand
2

Primary Astrocyte mRNA Profiling Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from primary astrocytes using the RNeasy Kit (QIAGEN) according to manufacturer’s suggestions. RNA was reversely transcribed with High Capacity cDNA RT Kit and amplified using TaqMan Universal PCR-Master Mix (Applied Biosystems). All samples were treated with DNase. Relative expression of target mRNAs was adjusted for total RNA content by Hprt (Mm01545399_m1). Inventoried Taqman probes were used: ATF4 Mm00515324_m1, ATF5 Mm04179654_m1, Hspa5 (BIP) Mm00517691_m1, Ddit3 (CHOP) Mm00492097_m1, Ppara (Pparα) Mm00440939_m1, FGF21 (Mm00840165_g1), mouse GLP-1R (Mm00445292_m1). To assess GLP-1R knock-out efficiency in primary astrocytes the following designed probes were used: Flag primer 5′913: GGACTACAAGGATGACGACGAC, 3′ 3580-152: CCCAAGGCACACAAAAAACC, mUTRprobe: 5′ FAM TGGCCATCCCAGGTGGGAGAGATCCT 3′TAMRA. Calculations were performed by a comparative method (2−ΔΔCT). Quantitative PCR was performed on an AB-QuantStudio 7 Flex (Applied Biosystems).
Timper K., del Río-Martín A., Cremer A.L., Bremser S., Alber J., Giavalisco P., Varela L., Heilinger C., Nolte H., Trifunovic A., Horvath T.L., Kloppenburg P., Backes H, & Brüning J.C. (2020). GLP-1 Receptor Signaling in Astrocytes Regulates Fatty Acid Oxidation, Mitochondrial Integrity, and Function. Cell Metabolism, 31(6), 1189-1205.e13.
+ Open protocol
+ Expand
3

Quantifying Mitochondrial Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA from N43/5 cells was extracted using the RNeasy® Kit (QIAGEN). RNA was reversely transcribed with High Capacity cDNA RT Kit and amplified using TaqMan® Universal PCR-Master Mix (Applied Biosystems). All samples were treated with DNase. Relative expression of target mRNAs was adjusted for total RNA content by Hprt (Mm01545399_m1). Inventoried Taqman probes were used: AIFm1 (Mm00442545_m1), CPT1b (Mm00487191_g1), PPARg (Mm00440945_m1). Calculations were performed by a comparative method (2−ΔΔCT). Mitochondrial DNA present per nuclear genome was determined using the following primer pairs: mitochondrial Nd2: fw: 5′- AGGGATCCCACTGCACATAG-3′; rev: 5′- CTCCTCATGCCCCTATGAAA-3′; mitochondrial D-Loop: fw: 5′- GGTTCT TACTTCAGGGCCATCA-3′, rev: 5′-GATTAGACCCGATACCATCGAGAT-3′; nuclear Nduv: fw: 5′- CTTCCCCACTGGCCTCAAG-3′; rev: 5′- CCAAAACCCAGTGATCCAGC-3′. Relative mitochondrial DNA content was calculated relative to nuclear DNA content based on the 2 × 2ΔCT method (Rooney et al., 2015 (link)). Quantitative PCR was performed on an AB-QuantStudio 7 Flex (Applied Biosystems).
Timper K., Paeger L., Sánchez-Lasheras C., Varela L., Jais A., Nolte H., Vogt M.C., Hausen A.C., Heilinger C., Evers N., Pospisilik J.A., Penninger J.M., Taylor E.B., Horvath T.L., Kloppenburg P, & Brüning J.C. (2018). Mild Impairment of Mitochondrial OXPHOS Promotes Fatty Acid Utilization in POMC Neurons and Improves Glucose Homeostasis in Obesity. Cell reports, 25(2), 383-397.e10.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!