Total RNA was extracted from the cell lines using Trizol Reagent (Invitrogen), and reverse-transcribed to cDNA using PrimeSciptTM RT reagent Kit with gDNA Eraser (Takara, China) following the manufacturer’s instructions. Quantitative real-time Polymerase Chain Reaction (qRT-PCR) was performed using FastStart Essential DNA Green Master (Roche, USA) and LightCycle® 96 Instrument (Roche, USA) following the manufacturer’s instructions. Primer sequences were: 5ʹ-CTCCATCCTGGCCTCGCTGT-3ʹ (forward) and 5ʹ-GCTGTCACCTTCACCGTTCC-3ʹ (reverse) for Actin; 5ʹ-GCGTTTGGTGGATGATTTCT-3ʹ (forward) and 5ʹ-GCGGTTGAAGGTGAGACTG-3ʹ (reverse) for hTERT; 5ʹ-CCTCAGCATCTTATCCGAGTGG-3ʹ (forward), 5ʹ-TGGATGGTGGTACAGTCAGAGC-3ʹ (reverse) for P53; 5ʹ-GGCCTGCTGAAAATGACTG-3ʹ (forward) and 5ʹ-GGTCCTGCACCAGTAATATG-3ʹ (reverse) for KRAS; 5ʹ-GTGAACCATGAGAAGTATGACAAC-3ʹ (forward) and 5ʹ-CATGAGTCCTTCCACGATACC-3ʹ (reverse) for GAPDH and 5ʹ-CCCGTAGGAAGAACCGATGA-3ʹ (forward) and 5ʹ-TTTAGGCCTTCGCAGACAGC-3ʹ (reverse) for lncRNA HOXA-AS2. The 2−ΔΔCT method was used to analyze relative changes in gene expression by calculating the fold change. Three replicate wells were prepared for each group, and the experiment was repeated thrice.
Primescipt rt reagent kit with gdna eraser
Manufactured by Takara Bio
Sourced in China, Japan
The PrimeScipt™ RT reagent Kit with gDNA Eraser is a tool designed for reverse transcription of RNA into cDNA. The kit includes a gDNA Eraser component that aids in the removal of genomic DNA contamination prior to cDNA synthesis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Sybr green supermix, by Bio-Rad (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Lightcycle 96 instrument, by Roche (1 mentions)
Faststart essential dna green master, by Roche (1 mentions)
Trizol reagent, by Wuhan Servicebio Technology (1 mentions)
Faststart universal sybr green master, by Roche (1 mentions)
Cfx96 system, by Bio-Rad (1 mentions)
Ethidium bromide, by Thermo Fisher Scientific (1 mentions)
Anatase tio2, by Merck Group (1 mentions)
Transit lt, by Mirus Bio (1 mentions)
Tb green premix ex taq, by Takara Bio (1 mentions)
Minibest universal rna extraction kit, by Takara Bio (1 mentions)
Cyt c, by Cell Signaling Technology (1 mentions)
P nf κb p65, by Cell Signaling Technology (1 mentions)
P ikkα, by Abcam (1 mentions)
5 ethynyl 2 deoxyuridine edu labeling detection kit, by RiboBio (1 mentions)
Cox 4, by Abcam (1 mentions)
N acetylcysteine nac, by Merck Group (1 mentions)
Caspase 3, by Cell Signaling Technology (1 mentions)
8 protocols using primescipt rt reagent kit with gdna eraser
1
Quantitative Analysis of Gene Expression
2
Quantifying CDKN2A Expression in Hepatocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNAs of hepatocyte and hepatocellular carcinoma cell lines were extracted with TRIzol reagent (Servicebio) following the manufacturer’s instructions. Then, the extracted RNA was reverse-transcribed into cDNA using a PrimeSciptTM RT reagent Kit with gDNA Eraser (Takara, Beijing, China). FastStart Universal SYBR Green Master (Roche, Shanghai, China) was then used for real-time fluorescence quantitative PCR analysis. The primer sequences were as follows: H-CDKN2A-F, 5ʹ-GGAGGCCGATCCAGGTCAT-3ʹ and H-CDKN2A-R, 5ʹ-CACCAGCGTGTCCAGGAAG-3ʹ; H-ACTB-F GTCATTCCAAATATGAGATGCGT, H-ACTB-R GCTATCACCTCCCCTGTGTG. In order to compare the expression levels of different samples, the relative expression level of the gene was calculated using the 2−ΔΔCt method. Each experiment was repeated at least three times independently.
3
Drought-Induced Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The petri dish experiment for root hair isolation was carried out once again using XZ5, XZ54 and Tadmor under control and 20% PEG 6000-induced drought conditions and the total RNA was isolated as described above. First-strand cDNA synthesis was performed with 1 μg of total RNA using the PrimeSciptTM RT reagent Kit with gDNA Eraser (Takara, Japan), according to the manufacturer’s instructions. The transcriptional profiles of five genes were analysed by quantitative real-time PCR (qRT-PCR) using the SYBR Green Supermix (Bio-Rad, USA) and a CFX96 system (Bio-Rad, USA). The expression levels of the tissue-enriched transcripts were normalized using an endogenous actin control. Each set of experiments was repeated three times, and the 2-ΔΔCq relative quantification method was used to evaluate quantitative variation. The primer sets used in this study to validate the RNA-Seq results are provided in Supplementary Table S1 .
4
RNA Quantification and Cell Transfection
5
Leaf RNA Extraction and Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from leaves using the TaKaRa MiniBEST Universal RNA Extraction Kit and used for cDNA synthesis with PrimeScipt™ RT reagent Kit with gDNA Eraser (TaKaRa, Beijing, China) after RNA concentration and quality assay with NanoDrop 2000 (Thermo, shanghai China). The quality was further examined using primers designed with the NtActin (U60489). And NtActin was used as the internal control in all qRT-PCR analyses. The primer sets used are listed in Supplementary Table 1
6
Chemopreventive Potential of Punicalagin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GA with 99% purity, 5-Fluorouracil (5-FU) and N-acetylcysteine (NAC) were obtained from Sigma (USA). Punicalagin, ellagic acid and punicalin with 99% purity were purchased from Chengdu Institute of biology, Chinese Academy of Sciences (Chengdu, China). CCK-8 kit was acquired from Dojindo (Japan). The 5-ethynyl-2-deoxyuridine (EdU) labeling/detection kit was purchased from Ribobio (Guangzhou, China). Annexin V-FITC apoptosis detection kit and PI/RNase Staining Buffer kit were obtained from BD Biosciences (Becton Dickinson, USA). ROS detection kit was obtained from Jiancheng Bioengineering (Nanjing, China). Mitochondrial Membrane Potential (MMP) detection kit was obtained from BestBio company (Shanghai, China). The primary antibodies against Cleaved Caspase-3, Caspase-3, P53, Bcl-2, Bax, Cyt-c, P-Akt, Akt, P-NF-κB p65, NF-κB p65, and P-IκBα were purchased from Cell Signaling Technology (CST, USA). The primary antibodies against PI3K, P-PI3K, P-IKKα, VEGF, COX-IV, and β-Actin were purchased from abcam (UK). The second antibody was obtained from LI-COR (USA). PrimeScipt™ RT reagent Kit with gDNA Eraser and SYBR@Premix Ex Taq™ II were obtained from Takara Bio (Japan). Minimum essential medium (MEM), fetal bovine serum (FBS), penicillin-streptomycin were purchased from Gibco (Grand Island, USA). Matrigel was obtained from BD Biosciences (San Jose, USA).
7
Transcriptional Profiling of Rice Growth
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated from the basal stem, leaf, leaf sheath, root, stem, and spike of wild-type plants at different growth stages, including seedling, tillering, stem elongation, booting, and heading, using a centrifugal filter kit according to the manufacturer’s instructions (Takara). First-strand cDNA synthesis was performed with 1 μg of total RNA using the PrimeScipt RT reagent kit with gDNA Eraser (Takara), according to the user manual. cDNA samples were diluted 3-fold, with 1 μL used for further analysis. qPCR analyses were performed using gene-specific primers Q-HNT1-F and Q-HNT1-R (Supplemental Table S1 ) in the reaction system of SYBR Green Supermix (Bio-Rad) on a Roche 480 real-time PCR machine (Roche). The basal stem of hnt1 and wild-type seedlings in the tillering stage was also used to analyze the gene expression of auxin-related genes. The barley ACTIN gene was used as an internal control. RT-qPCR was carried out with three biological and technical replications. The 2−ΔΔCq relative quantification method was used to evaluate quantitative variation. All primers are listed in Supplemental Table S1 .
8
Total RNA Isolation and cDNA Generation
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!