Sterile swabs collected at T0, T1, T2 and T3 were submitted to incubation with primary tissue cultures from ovine skin fibroblasts (OSF) and T-immortalized goat embryonic fibroblasts (TIGEF). Briefly, swabs were immersed in 2mL of tissue culture medium, DMEM supplemented with 1% glutamine, 2% foetal bovine serum and 2% antibiotics (Sigma Aldrich) and then added to cells. Cells were incubated at 37°C, 5% CO2 atmosphere for 5 days. DNA extraction was performed in cells using E.Z.N.A Blood DNA Mini Kit (Omega bio-tek). Orf virus detection and viral load quantification were conducted by real-time quantitative PCR in an Agilent AriaMx machine using commercial PCR EXOone Contagious Ecthyma (Exopol, Spain).
Ariamx machine
Manufactured by Agilent Technologies
Sourced in Spain, United States
The AriaMx machine is a real-time PCR system designed for analyzing gene expression, genotyping, and other applications. It features a compact design, flexible multi-well plate format, and advanced optical detection technology. The AriaMx provides accurate and reliable data for a variety of real-time PCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
Ariamx real time pcr software, by Agilent Technologies (3 mentions)
Taqman fast virus 1 step master mix, by Thermo Fisher Scientific (3 mentions)
Epmotion 5075, by Eppendorf (3 mentions)
Prism 4, by GraphPad (2 mentions)
Foetal bovine serum (fbs), by Merck Group (1 mentions)
E z n a blood dna mini kit, by Omega Bio-Tek (1 mentions)
Superscript 4 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Hiscript 2 one step rt pcr kit, by Vazyme (1 mentions)
Plus all in one first strand cdna synthesis supermix, by Novoprotein (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Agilent aria 1, by Agilent Technologies (1 mentions)
Nanodrop simplinano, by GE Healthcare (1 mentions)
Nzy total rna isolation kit, by NZYTech (1 mentions)
Nzy first strand cdna synthesis kit, by NZYTech (1 mentions)
7 protocols using ariamx machine
1
Orf Virus Detection in Ovine Cells
2
Validating RNA-seq Data with qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative reverse transcription-PCR (qRT-PCR) was performed with the Agilent AriaMx machine using the PowerUp SYBR green PCR master mix to validate the RNA-seq data. rpoB was used as an internal control to normalize the qRT-PCR data. DNase-treated total RNA to cDNA conversion was performed using Superscript IV reverse transcriptase (Invitrogen) according to the manufacturer’s instructions. All experiments were performed in biological duplicates and technical triplicates (n = 6). The comparative threshold cycle (2−ΔΔCT) method described previously (72 (link)) was used to quantify expression fold changes. We observed a strong correlation (>0.93) between qRT-PCR and RNA-seq data (Data Set S1 , qRT-PCR_validation sheet).
3
SAV3 Detection via Q_nsp1 Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SAV3 strain was detected using the Q_nsp1 assay [25 (link)]. This broad spectrum assay detects all known SAV subtypes using primers and probe (Table 1 ) with final concentrations of 500 and 300 nM, respectively, and amplifies a conserved region in the 5’ end of the nsp1 gene, giving amplicons of 107 bp. Extracted RNA was automatically pipetted by Eppendorf epMotion® 5075 (Eppendorf, Hamburg, Germany) in duplicates, analyzed by RT-qPCR on an AriaMx machine (Agilent Technologies, Santa Clara, CA, USA), and evaluated with the Agilent AriaMx Real-Time PCR software (version 1.7). Each plate included a negative control sample and an inter-plate calibrator of pure SAV3 RNA, which were both run in duplicates. The cut-off quantification cycle (Cq) value was set to 40; samples with values below this Cq in duplicates were considered positive. Samples with only one positive parallel were rerun and considered positive only with positive duplicates. The template volume was 2.0 μL RNA in a total reaction volume of 20 μL, and the RT-qPCR kit used was TaqMan® Fast Virus 1-Step Master Mix (Applied Biosystems®, Foster City, CA, USA). The thermal program comprised reverse transcription for 5 min at 50 °C and enzyme activation for 2 min at 95 °C, followed by 45 cycles of 15 s at 94 °C and 40 s at 60 °C.
4
Quantitative PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from
cells and xenograft tumors using RNAiso Plus (TaKaRa) following the
manufacturer’s protocol. First-strand cDNA synthesis from total
RNA was carried out using Plus All-in-One First-Strand cDNA Synthesis
SuperMix (Novoprotein). Resulting cDNA was then analyzed by quantitative
PCR (qPCR) using HiScript II One Step RT-PCR Kit (Vazyme, P611–01)
with an Agilent AriaMx machine. All RT-qPCRs were repeated at least
three times, and the relative abundance of each transcript was normalized
to the expression level of actin and then to the control samples.
Sequence information for all primers used for RT-qPCR was included
in theSupporting Table .
cells and xenograft tumors using RNAiso Plus (TaKaRa) following the
manufacturer’s protocol. First-strand cDNA synthesis from total
RNA was carried out using Plus All-in-One First-Strand cDNA Synthesis
SuperMix (Novoprotein). Resulting cDNA was then analyzed by quantitative
PCR (qPCR) using HiScript II One Step RT-PCR Kit (Vazyme, P611–01)
with an Agilent AriaMx machine. All RT-qPCRs were repeated at least
three times, and the relative abundance of each transcript was normalized
to the expression level of actin and then to the control samples.
Sequence information for all primers used for RT-qPCR was included
in the
5
RNA Extraction and qPCR Quantification of RND3 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For total RNA extraction, 5 × 105 RPMI 8226 or JJN3 cells were collected and washed with PBS. RNA extraction was performed using NZY total RNA Isolation kit (Nzytech) following the manufacturer’s instructions. Total RNA samples were quantified by optical density at 260/280 nm with Nanodrop Simplinano (GE Healthcare Life Science), and 1 µg was used for cDNA synthesis using the NZY First-Strand cDNA Synthesis kit (Nzytech). Finally, qPCR was made using the cDNA samples with the corresponding primers ( Table 3 ) and the commercial mix NZYSpeedy qPCR Green Master Mix (2x), ROX (Nzytech), which include a green intercalating dye, dNTPs, stabilizers, and enhancers. Human Large Ribosomal Protein (RPLP0) was used as a housekeeping gene. The qPCR was performed using an AriaMx machine (Agilent Technologies) and Agilent Aria 1.71 software (Agilent Technologies) for gene expression analysis. RND3 mRNA expression levels were analyzed and calculated as fold change using the 2−ΔΔCt method.
List of primers for the qPCR
| Gene | Sequence (5’-->3’) | Product length |
|---|---|---|
| GCAGACGCCAGTGTCCTAT | 192 pb | |
| ATCCGCTTTGTGGCTCTCTG | ||
| ACAACCCAGCTCTGGAGAAA | 240 pb | |
| TGCCCCTGGAGATTTTAGTG |
6
RT-qPCR Detection of SAV3 Strain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SAV3 strain was detected using the Q_nsP1 assay (Hodneland & Endresen 2006) . This broadspectrum assay detects all known SAV subtypes using primers and probe with final concentrations of 500 and 300 nM, respectively and amplifies a conserved region in the 5' end of the Q_nsP1-gene, giving amplicons of 107 bp (Table 2).
Extracted RNA was automatically pipetted by Eppendorf epMotion ® 5075 (Eppendorf) in duplicates, analyzed by RT-qPCR on an AriaMx machine (Agilent Technologies) and evaluated with the Agilent AriaMx Real-Time PCR software (version 1.7). Each plate included a negative control sample and an inter plate calibrator of pure SAV3 RNA, which were both run in duplicates.
The cut-off quantification cycle (Cq) value was set to 40; samples with values below this Cq in duplicates were considered positive. Samples with only one positive parallel were rerun and considered positive only with positive duplicates. The template volume was 2.0 μl RNA in a total reaction volume of 20 μl, and the RT-qPCR kit used was TaqMan ® Fast Virus 1-Step Master Mix (Applied Biosystems ® ). The thermal programme comprised reverse transcription for 5 min at 50°C and enzyme activation for 2 min at 95°C, followed by 45 cycles of 15 s at 94°C and 40 s at 60°C. GraphPad Prism 4.03 (GraphPad Software) was used to plot the data.
Extracted RNA was automatically pipetted by Eppendorf epMotion ® 5075 (Eppendorf) in duplicates, analyzed by RT-qPCR on an AriaMx machine (Agilent Technologies) and evaluated with the Agilent AriaMx Real-Time PCR software (version 1.7). Each plate included a negative control sample and an inter plate calibrator of pure SAV3 RNA, which were both run in duplicates.
The cut-off quantification cycle (Cq) value was set to 40; samples with values below this Cq in duplicates were considered positive. Samples with only one positive parallel were rerun and considered positive only with positive duplicates. The template volume was 2.0 μl RNA in a total reaction volume of 20 μl, and the RT-qPCR kit used was TaqMan ® Fast Virus 1-Step Master Mix (Applied Biosystems ® ). The thermal programme comprised reverse transcription for 5 min at 50°C and enzyme activation for 2 min at 95°C, followed by 45 cycles of 15 s at 94°C and 40 s at 60°C. GraphPad Prism 4.03 (GraphPad Software) was used to plot the data.
7
RT-qPCR Detection of SAV3 Strain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SAV3 strain was detected using the Q_nsP1 assay (Hodneland & Endresen 2006) . This broadspectrum assay detects all known SAV subtypes using primers and probe with final concentrations of 500 and 300 nM, respectively and amplifies a conserved region in the 5' end of the Q_nsP1-gene, giving amplicons of 107 bp (Table 2).
Extracted RNA was automatically pipetted by Eppendorf epMotion ® 5075 (Eppendorf) in duplicates, analyzed by RT-qPCR on an AriaMx machine (Agilent Technologies) and evaluated with the Agilent AriaMx Real-Time PCR software (version 1.7). Each plate included a negative control sample and an inter plate calibrator of pure SAV3 RNA, which were both run in duplicates.
The cut-off quantification cycle (Cq) value was set to 40; samples with values below this Cq in duplicates were considered positive. Samples with only one positive parallel were rerun and considered positive only with positive duplicates. The template volume was 2.0 μl RNA in a total reaction volume of 20 μl, and the RT-qPCR kit used was TaqMan ® Fast Virus 1-Step Master Mix (Applied Biosystems ® ). The thermal programme comprised reverse transcription for 5 min at 50°C and enzyme activation for 2 min at 95°C, followed by 45 cycles of 15 s at 94°C and 40 s at 60°C. GraphPad Prism 4.03 (GraphPad Software) was used to plot the data.
Extracted RNA was automatically pipetted by Eppendorf epMotion ® 5075 (Eppendorf) in duplicates, analyzed by RT-qPCR on an AriaMx machine (Agilent Technologies) and evaluated with the Agilent AriaMx Real-Time PCR software (version 1.7). Each plate included a negative control sample and an inter plate calibrator of pure SAV3 RNA, which were both run in duplicates.
The cut-off quantification cycle (Cq) value was set to 40; samples with values below this Cq in duplicates were considered positive. Samples with only one positive parallel were rerun and considered positive only with positive duplicates. The template volume was 2.0 μl RNA in a total reaction volume of 20 μl, and the RT-qPCR kit used was TaqMan ® Fast Virus 1-Step Master Mix (Applied Biosystems ® ). The thermal programme comprised reverse transcription for 5 min at 50°C and enzyme activation for 2 min at 95°C, followed by 45 cycles of 15 s at 94°C and 40 s at 60°C. GraphPad Prism 4.03 (GraphPad Software) was used to plot the data.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!