Total RNA was isolated with RNeasy RNA isolation kit (Qiagen, Hilden, Germany), mature miRNAs were individually reverse-transcribed by TaqMan miRNA Reverse Transcription Kit and miRNA relative expression was quantified by specific TaqMan miRNA Assays in TaqMan Fast Universal PCR Mix. miRNA expression was normalized against RNU44 using the ΔΔCt method. mRNAs were randomly reverse-transcribed by High Capacity RNA-to-cDNA Kit and relative expression was measured by Power SYBR Green PCR Master Mix (all from Life Technologies Inc). Relative expression values were calculated using ΔΔCt method against RPLP0 and HPRT1 endogenous controls. All reactions were run on the Viia-7TM Real-Time PCR System (Life Technologies Inc). The primer sequences used for RT-qPCR are listed in Supplementary Table 3 .
Viia 7tm real time pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ViiA 7TM Real-time PCR System is a quantitative real-time PCR instrument designed for accurate and reliable gene expression analysis. It provides precise temperature control and optical detection for real-time PCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
M mlv reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Taqman mirna reverse transcription kit, by Qiagen (1 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Rneasy rna isolation kit, by Qiagen (1 mentions)
Sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Perfecta sybr green supermix low rox, by Quantabio (1 mentions)
Nucleospin rna kit, by Macherey-Nagel (1 mentions)
Fast sybr green qpcr mastermix, by Thermo Fisher Scientific (1 mentions)
K file, by Dentsply (1 mentions)
Miscript sybr green pcr system, by Qiagen (1 mentions)
Mirneasy mini kit, by Qiagen (1 mentions)
Miscript 2 rt kit, by Qiagen (1 mentions)
Taqman universal master mix, by Thermo Fisher Scientific (1 mentions)
Quantstudio 6, by Thermo Fisher Scientific (1 mentions)
Quantstudio 7, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
9 protocols using viia 7tm real time pcr system
1
Comprehensive mRNA and miRNA Expression Analysis
2
Gene Expression Analysis via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression was analyzed using total RNA phenol-chloroform extracted from cell lines using cell TRIzolTM Reagent according to manufacturer instructions. Briefly, 3 ug of total RNA was reverse transcribed using M-MLV reverse transcriptase (Invitrogen) in the presence of oligo-dT primer. Next, quantitative PCR was performed using SYBR-Green Master Mix (LifeTechnologies) and specific primers (Supplemental Table 1 ) in ViiA7TM Real-Time PCR System (LifeTechnologies), and gene expression was calculated using Q-Gene program (17 (link)).
3
Gene Expression Analysis by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the NucleoSpin® RNA kit (Macherey-Nagel) and reverse transcribed with M-MLV reverse transcriptase (Thermo Fisher Scientific). Real-time PCR was performed using the PerfeCTa SYBR Green SuperMix low ROX (Quantabio) on a ViiA 7TM Real-Time PCR System (Thermo Fisher Scientific). Fold induction of Zfp597 was calculated relative to Rpl19 whereas Stat1 was compared to Actb by using the 2-ΔΔCt method. Standard curves of all primers were performed by testing serial dilutions of cDNA-experimental samples obtaining an average of 100 ± 5% efficiency. Correlation between target and housekeeping genes was assessed by standard curve comparisons (Zfp597-Rpl19 slope 0.0194 / Stat1-Actin slope 0.0188). Details about the primers used can be found as Supplementary Information.
4
Dental Pulp Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A qRT-PCR analysis was performed on the DP of teeth extracted 3 h after the implantation of fibrin and fibrin-chitosan hydrogel formulations. 12 upper incisors from 6 rats were used for each condition (fibrin, fibrin-chitosan). Healthy maxillary incisors were used as a control. The incisors were split longitudinally into two halves and the pulp tissues were carefully removed using a sterile K file (Dentsply Maillefer, Ballaigues, Switzerland). Total RNA was extracted using an RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. For cDNA synthesis, 1 µg of total RNA was used as a template for reverse transcription with a High-Capacity cDNA Reverse Transcription Kit (Invitrogen). PCR was performed in a Viia7 TM Real Time PCR System (Thermo Fisher Scientific) with a Fast SYBR Green qPCR Master Mix (Life Technologies). Primer sequences are listed in Table 1. The transcript expression level was defined as a foldchange of the mRNA level in a given sample relative to the calibrator level. The DP of untreated teeth was used as a calibrator, this defined the 1× expression of each gene, and the mRNA expression level was calculated as 2 -ΔΔCt where ΔΔCt = (CtTarget -CtHPRT) sample -(CtTarget -CtHPRT) calibrator.
5
Quantification of miR-628 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tibialis anterior muscle samples or L6 myoblast transfectants were collected, and total RNA was extracted using an miRNeasy Mini Kit (Qiagen, Valencia, CA, USA). A miScript II RT kit (Qiagen, Valencia, CA, USA) was employed for first-strand cDNA synthesis, and miR-628 expression was subsequently detected using an miScript SYBR Green PCR system (Qiagen, Valencia, CA, USA) with a ViiA 7TM Real-time PCR System (Applied Biosystems, Foster City, CA, USA). The following primers were used in this study: miR-628 (forward: 5'-GGGGGATGCTGACATATTTAC-3' and reverse: 5'-CAGTGCGTGTCGTGGAGT-3') and U6 (forward: 5'-GCTTCGGCAGCACATATACTAAAAT-3' and reverse: 5'-CGCTTCACGAATTTGCGTGTCAT-3'). Initial activation was performed at 95℃ for 10 min, followed by 40 cycles of denaturation at 95℃ for 10 sec and annealing and extension at 60℃ for 60 sec. Data were analyzed using the 2-△△T method.
6
Quantitative RT-PCR Analysis of Gonadal Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from individual gonads or gonad pairs using RNeasy Micro Kit (Qiagen, #74004) or RNeasy Mini Kit (Qiagen, #74106) including on-column DNase treatment. Total RNA-containing eluate was immediately used for cDNA synthesis by reverse transcription using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, #4368813). For fetal gonadal samples and the time course of Sox30 and Stra8 expression in the postnatal testis qRT-PCR was performed on a Viia7TM Real-Time PCR System (Applied Biosystems). Expression levels of Dmc1 (Mm00494485_m1), Rec8 (Mm00490939_m1), Sox30 (Mm00557681_m1), Stra8 (Mm00486473_m1) and Sycp3 (Mm00488519_m1) relative to Ddx4 (Mm00802445t_m1) or Tbp (Mm01277045_m1) were quantified using Taqman Gene Expression Assays and Universal Taqman Master Mix (Applied Biosystems, #4318157). To investigate the effects of Sox30 ablation in 19 dpp and 25 dpp testis, qRT-PCR was performed on a Quantstudio6 and Quantstudio7 (Applied Biosystems) respectively using primers listed in Supplementary Table S2 online and SYBR Green PCR Master Mix (Applied Biosystems, #4309155). Relative cDNA levels were determined by the 2−ΔCT method. All kits and assays were performed according to instructions supplied by the manufacturer.
7
Respiratory Microbiome Detection during COVID-19
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sample collection period overlapped with the start of the COVID-19 pandemic in the UK. To determine the presence of coronavirus all samples were tested for the Beta-CoV E gene and SARS-CoV-2 S gene targets. A clinically validated 45-microbe low density TaqMan Array Card (TAC) (Applied Biosystems, Foster City, CA, USA) was used to detect common respiratory microbes, using exogenous controls (T4 and MS2 bacteriophage gene targets), endogenous human controls (human 18S rRNA and RNase-P gene targets), see supplementary Table S2 for a full list of microbe gene targets [38 (link)].
Samples were run in 3 batches, amplified, and analysed using a Life Technologies Custom TaqMan Low Density Array system on an Applied Biosystems Life Technologies ViiA-7TM real-time PCR system as described elsewhere [39 (link)]. A cycle threshold (Ct) value < 38 for any gene target was reported as a positive result. Incidence of microbe carriage prevalence was calculated as the number of positive results as a percentage of all positive results. The Pearson’s chi-squared test with a Bonferroni-adjusted P value was used to determine significance between observed proportions of microbial carriage.
Samples were run in 3 batches, amplified, and analysed using a Life Technologies Custom TaqMan Low Density Array system on an Applied Biosystems Life Technologies ViiA-7TM real-time PCR system as described elsewhere [39 (link)]. A cycle threshold (Ct) value < 38 for any gene target was reported as a positive result. Incidence of microbe carriage prevalence was calculated as the number of positive results as a percentage of all positive results. The Pearson’s chi-squared test with a Bonferroni-adjusted P value was used to determine significance between observed proportions of microbial carriage.
8
Real-Time qPCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA (10 ng) was used as a template, and primers were mixed with FastStart Universal SYBR Green Master Mix (Roche). Fluorescence was measured on a ViiA7TM Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific). The expression levels were normalized to the house-keeping genes GAPDH (for MDM), ACTB, and 18S (for PBMCs). Relative gene expression was calculated as 2ΔCT [ΔCT = CT(Housekeeper) − CT(Gene)]. Primer sequences for RT qPCR are shown in Table 1 .
9
Quantifying PI3K/AKT Pathway Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from mice’ liver using Trizol Reagent. The concentration of RNA was determined by absorbance at 260 nm. The values of all RNA samples at absorbance 260/280 ranged between 1.8 and 2.0. Total RNA was quantified and reverse-transcribed into cDNA using a Reverse Transcriptase M-MLV (RNase H-) kit (Takara, Japan). The mRNA expressions were then quantified by RT-qPCR using the AceQTM qPCR SYBR Green Master Mix (Takara, Japan) and an Applied Biosystems ViiA 7TM Real-Time PCR System. PCR amplification was performed using the following conditions: initial activation of the hot-start DNA polymerase for 1min at 95 °C followed by 45 cycles (95 °C for 10s and 59 °C for 20 s) (Liang et al., 2018 (link)). Gene expression was normalized to the geometric mean of the reference genes (β-actin) using the 2-△△Ct method. The specific primers, which include both sense and antisense, were used for the amplification of DNA (Table 1 ).Table 1
Designed primer sets for RT-PCRa.
| gene | primer | sequence (5′-3′) | size (bp) |
|---|---|---|---|
| PI3K | sense | ACAAAGCTCTACTCTAGGCGTG | 242 |
| antisense | TTACCAGCATGGTCATGGGC | ||
| AKT | sense | AGAGAGCCGAGTCCTACAGAATA | 133 |
| antisense | CCGAGAGAGGTGGAAAAACA | ||
| GSK-3β | sense | TCGTCCATCGATGTGTGGTC | 202 |
| antisense | TTGTCCAGGGGTGAGCTTTG | ||
| GS | sense | TTGCCAGAATGCACGCAGAA | 270 |
| antisense | TGCCTGCATCATCTGTTGAC | ||
| β-actin | sense | GATCGATGCCGGTGCTAAGA | 367 |
| antisense | TCCTATGGGAGAACGGCAGA |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!