Lc3b sirna

HeLa cells were transfected with LC3B siRNA (Cell Signalling Technology, 6213, 100 nM) or Atg5 siRNA (Cell Signalling Technology, 6345, 100 nM) using Lipofectamine RNAiMAX as per manufacturer protocol. The efficiency of knockdown was assessed at 24 h (for LC3) and 48 h (for Atg5) after transfection by western blot. The following primary antibodies were used: LC3 (rabbit polyclonal, MBL, PM036, 1:1000), Atg5 (rabbit polyclonal, Cell Signalling Technology, 2630, 1:1000) and β actin (mouse monoclonal, Abcam, ab8224, 1:1000). The expression level of the target genes was calculated as the ratio of target gene to β actin (loading control).

The RNAi sequences (5′GCAUAUGCUGCAGGUAGAU3′ [35 (link)] and 5′AAGGAAAGTGAAGGTGGGCAA3′ [36 (link)]) against human AMPK-α1/2 were synthesized by GENEWIZ, Inc. (Suzhou, China). Non-sense control RNAi was purchased from Santa Cruz and was used as RNAi-negative control. Beclin-1 siRNA and LC3B siRNA were purchased from Cell Signaling Tech (Shanghai, China). Transfection was performed as described before [37 (link)]. Briefly, HepG2 cells were cultured on a six-well plate with 60% confluence in antibiotic- and serum-free medium. Targeted and control RNAi (100 μM) and 3.0 μl of Lipofectamine PLUS Reagent (Invitrogen, Carlsbad, CA) were diluted in 90 μl of siRNA dilution buffer (Santa Cruz). To this was added 3 μl of Lipofectamine LTX. The transfection complex was then added to the well containing 1 ml of DMEM for 12 hours, with a final RNAi concentration of 100 nM. Growth medium was then added back to the cells, which were cultured for additional 48 hours. Expression level of target proteins in transfected cells was always tested by western blots. Only cells with target protein significant-knockdown were used for experiments.