Nanodrop 8 000 microvolume uv vis spectrophotometer

To identify the expression of miR‐338‐3p, FURIN mRNA and BDNF mRNA in each sample, RT‐qPCR was performed. Specifically, Trizol reagent (Thermo Fisher Scientific) was applied to the complete RNA extracted from peripheral blood samples from patients from both groups in compliance with the experimental standards obtained from the handbook of the manufacturer. Then, the extracted total RNA was assayed with NanoDrop™ 8,000 Microvolume UV‐Vis Spectrophotometer (Thermo Fisher Scientific) using the instruction from the manual of the instrument obtained from the manufacturer of the machine, to establish RNA top standard. This was followed by qPCR to conduct the investigation of the quantitative changes in the target genes. The expression of miR‐338‐3p (Forward: 5′‐ATATCCTGGTGCTGAGTG′; Reverse: 5′‐ GAACATGTCTGCGTATCTC‐3′), FURIN mRNA (Forward: 5′‐GCCACATGACTACTCCGCAGAT‐3′; Reverse: 5′‐TACGAGGGTGAACTTGGTCAGC‐3′) and BDNF mRNA (Forward: 5′‐ CATCCGAGGACAAGGTGGCTTG‐3′; Reverse: 5′‐GCCGAACTTTCTGGTCCTCATC‐3′) in each sample was determined using the 2^− ΔΔCt method.

Native Limnoria hemocyanin (160 µg mL⁻¹, 2.2 µm) or Trametes versicolor laccase (184 µg mL⁻¹, 3.3 µm, equivalent to 1U; Sigma) were incubated with 1 mm pyrogallol in 100 µL of 0.1 m NaPO₄ pH 6.8 at room temperature for up to 45 min. Enzyme activity of hemocyanin was induced with 2.75 mm SDS and buffer controls only lacked the protein. Ultra violet-Visible absorbance spectra of aliquots were scanned from 220 to 750 nm in a NanoDrop 8000 Microvolume UV-Vis spectrophotometer (Thermo Scientific) at regular intervals.
To monitor the effect of chelators on oxygen binding to the copper center of hemocyanin, 50 mm of either ethylene diamine tetra-acetic acid (EDTA), ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′ tetra-acetic acid (EGTA), or diethylene triamine penta-acetic acid (DTPA) was mixed with hemocyanin extract in seawater and scanned as above.