Protoscript 2 first strand cdna synthesis kit

Manufactured by New England Biolabs

Sourced in United States, United Kingdom, Germany

The ProtoScript II First Strand cDNA Synthesis Kit is a tool used for the conversion of RNA into complementary DNA (cDNA). It includes a reverse transcriptase enzyme and other necessary reagents to facilitate this process.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (37 mentions) Rneasy mini kit, by Qiagen (30 mentions) Trizol, by Thermo Fisher Scientific (27 mentions) Luna universal qpcr master mix, by New England Biolabs (16 mentions) Powerup sybr green master mix, by Thermo Fisher Scientific (16 mentions) Steponeplus real time pcr system, by Thermo Fisher Scientific (11 mentions) Rneasy plant mini kit, by Qiagen (8 mentions) Itaq universal sybr green supermix, by Bio-Rad (8 mentions) Dnase 1, by Thermo Fisher Scientific (7 mentions) Rneasy plus mini kit, by Qiagen (7 mentions) Qiaamp viral rna mini kit, by Qiagen (7 mentions) Tri reagent, by Merck Group (7 mentions) Monarch total rna miniprep kit, by New England Biolabs (6 mentions) Qiazol lysis reagent, by Qiagen (6 mentions) Sybr select master mix, by Thermo Fisher Scientific (6 mentions) Perfecta sybr green supermix, by Quantabio (5 mentions) Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (5 mentions) Direct zol rna miniprep, by Zymo Research (5 mentions) Nebnext ultra 2 non directional rna second strand synthesis module, by New England Biolabs (5 mentions) Qiaquick pcr purification kit, by Qiagen (5 mentions)

Close spelling variants of this product

ProtoScript II (94 citations) ProtoScript cDNA synthesis kit (18 citations) ProtoScript II cDNA Synthesis Kit (12 citations) Protoscript II First Strand Synthesis Kit (8 citations) CDNA synthesis kit (5 citations) NEB ProtoScript II First Strand cDNA Synthesis Kit (5 citations) ProtoScript II cDNA first strand kit (4 citations) ProtoScript II First Strand cDNA Synthesis (3 citations) ProtoScript(R) II First-Strand cDNA Synthesis Kit (2 citations) Protoscript® M-MuLV II First Strand cDNA Synthesis Kit (2 citations)

316 protocols using protoscript 2 first strand cdna synthesis kit

Quantitative Analysis of Polyadenylation

Check if the same lab product or an alternative is used in the 5 most similar protocols

qPCR was performed using PerfeCTa SYBR Green SuperMix (QuantaBio) in triplicates. All primer sequences are listed in Supplementary file 4. For mRNA quantification, reverse transcription was performed using ProtoScript II First Strand cDNA Synthesis Kit (NEB) using d(T)₂₃VN primer with DNase I (Invitrogen) digestion on 1 μg total RNA generated from Trizol (Invitrogen) extraction. The cycling parameters for qPCR were 95°C for 10 min. followed by 40 cycles of 95°C for 15 s, 58°C for 30 s, and 72°C for 20 s. Quantification was calculated using the ΔΔCt method with the following endogenous controls: ACTB (human) and Rplp0 (mouse).
For PAS reporter assay, reverse transcription was performed using ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs) using an anchored d(T) primer (R1-T25-VN) with DNase I (Invitrogen) digestion on 1 μg total RNA generated from Trizol (Invitrogen) extraction. qPCR quantification of the proximal and distal mRNA isoforms generated from each PAS reporter is performed using a PAS specific forward primer and a common reverse primer complementary to the anchoring sequence of R1-T25-VN. The cycling parameters for qPCR were 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, 58°C for 30 s, and 72°C for 8 s. Quantification was calculated using the ΔΔCt method relative to the distal mRNA isoform that uses the bGH PAS.

Herron R.S., Kunisky A.K., Madden J.R., Anyaeche V.I., Maung M.Z, & Hwang H.W. (2023). A twin UGUA motif directs the balance between gene isoforms through CFIm and the mTORC1 signaling pathway. eLife, 12, e85036.

+ Open protocol

+ Expand

Cryptic Exon Detection by RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from samples using the Monarch^® Total RNA Miniprep Kit (New England Biolabs, #T2010S) and cDNA was synthesized using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, #E6560L). cDNA was amplified using primer pairs designed to either target two wildtype sequences on either side of the cryptic exon or one wildtype sequence and another sequence directly in the cryptic exon. Target sequence amplification was performed using Phusion Plus Green PCR Master Mix (Thermo Scientific, #F632L) and a modified touchdown PCR protocol (92 (link)), described below. Amplified targets were then separated by 1.5% agarose gel electrophoresis and visualized by ethidium bromide staining.
PCR protocol:
We used two types of primer pairs to amplify targets. The first type comprises a primer targeting the cryptic exon and another targeting an adjacent canonical exon, which we term single-band primers. Consequently, RT-PCR amplification would occur only when transcripts containing cryptic exons are in the sample. This leads to the amplification of cryptic exon-containing RNA at low levels. In the second type, both primers bind canonical mRNA flanking the cryptic exon, which we term double-band primers. Accordingly, two potential transcripts are amplified through RT-PCR: the wildtype and the heavier cryptic exon-including one.
Primers utilized to amplify cryptic exons:

Sinha I.R., Sandal P.S., Burns G.D., Mallika A.P., Irwin K.E., Cruz A.L., Wang V., Rodríguez J.L., Wong P.C, & Ling J.P. (2024). Large-scale RNA-seq mining reveals ciclopirox triggers TDP-43 cryptic exons. bioRxiv.

+ Open protocol

+ Expand

Quantitative Analysis of HSV-1 Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from 2D NPC cultures was extracted using an RNeasy Plus kit (catalog no. 74134; Qiagen). Reverse transcription was performed with random primer mix using a ProtoScript II first-strand cDNA synthesis kit (catalog no. E6560S; New England BioLabs, Inc.) following the manufacturer’s instructions.
The qPCR was performed using Applied Biosystems TaqMan gene expression master mix (catalog no. 4369016; Thermo Fisher Scientific). The following primers were used: LAT intron F (5′-CGCCCCAGAGGCTAAGG-3′), LAT intron R (5′-GGGCTGGTGTGCTGTAACA-3′), LAT intron probe (5′-CCACGCCACTCGCG-3′), ICP4 F (5′-CACGGGCCGCTTCAC-3′), ICP4 R (5′-GCGATAGCGCGCGTAGA-3′), ICP4 probe (5′-CCGACGCGACCTCC-3′), TK F (5′-CACGCTACTGCGGGTTTATATAGAC-3′), TK R (5′-GGCTCGGGTACGTAGACGATAT-3′), TK probe (5′-CACCACGCAACTGC-3′), gC F (5′-CCTCCACGCCCAAAAGC-3′), gC R (5′-GGTGGTGTTGTTCTTGGGTTTG-3′), and gC probe (5′-CCCCACGTCCACCCC-3′).

Zheng W., Klammer A.M., Naciri J.N., Yeung J., Demers M., Milosevic J., Kinchington P.R., Bloom D.C., Nimgaonkar V.L, & D’Aiuto L. (2020). Patterns of Herpes Simplex Virus 1 Infection in Neural Progenitor Cells. Journal of Virology, 94(16), e00994-20.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Immune Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared using the E.Z.N.A. Total RNA Kit I (Omega Bio-Tek Inc, R6834). 400 ng of RNA was reverse transcribed into cDNA using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs®, E6560L). For one real-time reaction, 5 µL of Maxima SYBR Green/ROX qPCR Master Mix (2×) (Thermo Scientific), with 100 ng of the synthesized cDNA plus an appropriate random primer mix, were analyzed on a C1000 Touch Thermal Cycler CFX96 Real-Time System (Bio-Rad). The comparative Ct method was used to determine the relative mRNA expression of genes normalized by the housekeeping gene GAPDH. The primer sequences: mouse Gapdh, forward primer 5‘- gcggcacgtcagatcca -3‘, reverse primer 5‘- catggccttccgtgttccta -3‘; mouse Ifnb1, forward primer 5‘- cagctccaagaaaggacgaac -3‘, reverse primer 5‘- ggcagtgtaactcttctgcat -3‘; mouse Cxcl10 (IP10), forward primer 5‘- ccaagtgctgccgtcattttc -3‘, reverse primer 5‘- ggctcgcagggatgatttcaa -3‘; mouse Ccl5 (RANTES), forward primer 5‘- gctgctttgcctacctctcc -3‘, reverse primer 5‘-tcgagtgacaaacacgactgc-3‘; GFP, forward primer 5‘- aagggcatcgacttcaagg -3‘, reverse primer 5‘- tgcttgtcggccatgatatag -3‘; HSV-1 VP16, forward primer 5‘- ggactgtattccagcttcac -3‘, reverse primer 5‘- cgtcctcgccgtctaagtg -3‘.

Wu Y., Song K., Hao W., Li J., Wang L, & Li S. (2022). Nuclear soluble cGAS senses double-stranded DNA virus infection. Communications Biology, 5, 433.

+ Open protocol

+ Expand

Embryonic Gonad RNA Isolation and qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Embryonic gonads were dissected from the underlying mesonephros for all embryonic stages, except 11.5 dpc where the complex remained intact, and snap-frozen in liquid nitrogen. Total RNA was isolated using Trizol (Ambion) and single-stranded cDNA synthesised using the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). qPCR was performed with the SensiFAST SYBR No-ROX Kit (Bioline) using the Rotor-Gene 3000 system (Qiagen). Primers used can be found in Supplementary Table 1. Relative mRNA levels were normalised to Sdha and are shown relative to controls as indicated in the Figure legends. Each reaction was performed in technical triplicate and each experiment was performed with at least three biological replicates. Error bars represent the standard error of the mean (SEM) between biological replicates. Statistical significance between groups was determined using a two-tailed, unpaired Student’s t-test.

Windley S.P., Mayère C., McGovern A.E., Harvey N.L., Nef S., Schwarz Q., Kumar S, & Wilhelm D. (2022). Loss of NEDD4 causes complete XY gonadal sex reversal in mice. Cell Death & Disease, 13(1), 75.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Angiogenic Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells using a NucleoSpin RNA II kit (Macherey-Nagel, Düren, Germany) following the manufacturer's instructions. One microgram of total RNA was reverse transcribed into cDNA using ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA). Quantitative real-time PCR analyses were performed to determine the expression of the target genes: vascular endothelial growth factor (VEGF), von-Willebrand factor (v-WF), and CD31. β-actin was selected as a housekeeping gene for mRNA normalization. Specific primers for the genes v-WF and CD31 were designed using the GenScript primer design tool (https://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool). Primers for VEGF and β-actin were designed as previously described.^{35 (link)} Quantitative real-time PCR was conducted in duplicate sets for each sample using SyGreen Blue Mix Hi-ROX (PCR Biosystems, London, United Kingdom) in a StepOnePlus Real-Time PCR System (Applied Biosystems).

Shapira E., Plonski L., Menashe S., Ofek A., Rosenthal A., Brambilla M., Goldenberg G., Haimowitz S, & Heller L. (2022). High-Quality Lipoaspirate Following 1470-nm Radial Emitting Laser-Assisted Liposuction. Annals of Plastic Surgery, 89(6), e60-e68.

+ Open protocol

+ Expand

Quantifying mRNA Expression Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was extracted with TriPure (Roche, 11667165001) according to the manufactures instructions. RNA purity and concentration was measured using the Synergy H2 multi-mode reader with a Take3 Micro-Volume plate adapter (Biotek). ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, E6560L). ProtoScript II First Strand cDNA Synthesis Kit was used to reverse transcribe 0.5 μg of total RNA. RT-qPCR was performed in triplicate with gene-specific, intron-spanning primers (Table 1) using a Mastercycler EP Realplex² (Eppendorf, EPPE6300000.604) with SYBR Green PCR Master Mix (Roche, 04707516001). Relative mRNA expression levels were calculated using the ΔΔ^-2CT method [46 (link)]. Hypoxanthine phosphoribosyltransferase 1 (Hprt-1) was used as a housekeeping gene.

Linscott M.L, & Chung W.C. (2019). TET1 regulates fibroblast growth factor 8 transcription in gonadotropin releasing hormone neurons. PLoS ONE, 14(7), e0220530.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using QIAzol Lysis Reagent and isolated using RNAeasy mini kit (both from QIAGEN). cDNA synthesis was performed using the ProtoScript II First Strand cDNA Synthesis Kit (NEB). Expression levels of target genes were determined by RT-PCR using SensiMix SYBR No-Rox (Bioline) with the primers shown in Supplementary Table 1. Reactions were run on an MX3000P real-time thermal cycler (Agilent Technologies) and Ct values determined using MxPro qPCR software. Relative expression levels were calculated using the 2^-ΔCt method after normalising to the expression levels of the housekeeping gene, Gapdh. Fold change levels were calculated using the 2^-ΔΔCt method after normalising to the untreated control.

Wong C.W., Evangelou C., Sefton K.N., Leshem R., Zhang W., Gopalan V., Chattrakarn S., Fernandez Carro M.L., Uzuner E., Mole H., Wilcock D.J., Smith M.P., Sergiou K., Telfer B.A., Isaac D.T., Liu C., Perl N.R., Marie K., Lorigan P., Williams K.J., Rao P.E., Nagaraju R.T., Niepel M, & Hurlstone A.F. (2023). PARP14 inhibition restores PD-1 immune checkpoint inhibitor response following IFNγ-driven acquired resistance in preclinical cancer models. Nature Communications, 14, 5983.

+ Open protocol

+ Expand

Comprehensive LCMV RNA Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral RNA was reverse transcribed utilizing the ProtoScript^®II First Strand cDNA Synthesis Kit (New England Biolabs GmbH, Frankfurt, Germany) and random primers according to the manufacturer’s protocol. LCMV-WE and LCMV-Docile cDNA was amplified with Taq DNA Polymerase (Qiagen, Hilden, Germany) and overlapping LCMV-specific primer pairs to cover the S-segment and L-segment of both LCMV strains. Purified PCR products (Qia Quick PCR purification Kit) were sequenced utilizing the Big Dye^TM Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems^TM) and analyzed on a Prism Genetic Analyzer 3130-16 (Applied Biosystems^TM). Terminal Sequences (5’ and 3’ ends) of S- and L-segments were obtained from viral RNA utilizing the Superscript^TM IV First-Strand Synthesis System (Thermo Fisher Scientific) according to the manufacturer’s protocol and gene specific primer for first-strand synthesis, followed by dA tailing and second strand synthesis with oligo-T-tailed primers. The second strand synthesis product was PCR amplified utilizing Q5^® Hot Start High-Fidelity DNA polymerase (New England Biolabs GmbH, Frankfurt, Germany) oligo -T-tailed primers and nested gene specific primers. Purified PCR products were sequenced with nested gene specific primers as described above.

Xu H.C., Wang R., Shinde P.V., Walotka L., Huang A., Poschmann G., Huang J., Liu W., Stühler K., Schaal H., Bergthaler A., Pandyra A.A., Hardt C., Lang K.S, & Lang P.A. (2021). Slow viral propagation during initial phase of infection leads to viral persistence in mice. Communications Biology, 4, 508.

+ Open protocol

+ Expand

Quantitative PCR for IRT2 Expression

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Reverse transcription and quantitative PCR for IRT2 performed as described previously (Moretto et al, 2018; Tam & (link)
van, Werven, 2020 (link)). In short, total RNA was purified using the NucleoSpin RNA kit (Macherey-Nagel) according to the manufacturer’s instructions. For reverse transcription, the ProtoScript II First Strand cDNA Synthesis Kit (New England BioLabs) was used and 500 ng of total RNA was provided as template in each reaction. qRT-PCR reactions were prepared using EXPRESS SYBR GreenER SuperMix (Thermo Fisher Scientific), and IRT2 levels were quantified on the Applied Biosystems 7500 Fast Real-Time PCR System (Thermo Fisher Scientific). The result of n = 3 biological replicates are shown. Signals were normalised over ACT1. Primer sequences are listed in Table S4.

Wu A.C., Vivori C., Patel H., Sideri T., Moretto F, & van Werven F.J. (2022). RSC and GRFs confer promoter directionality by restricting divergent noncoding transcription. Life Science Alliance, 5(12), e202201394.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!