Phusion hot start 2 polymerase

PCR primers for the construction of IsaA protein-expressing plasmids are shown in Supplementary Table 1. DNA was isolated with the Genelute bacterial genomic DNA kit (Sigma-Aldrich, Zwijndrecht, The Netherlands). PCR was performed with the Phusion Hot Start II polymerase (Thermo Fisher Scientific, Wilmington, Delaware USA) using genomic DNA of S. aureus NCTC8325 as a template as described before^{34 (link)}. The PCR fragments purified using the High Pure PCR purification kit (Analytic Jena, Jena, Germany) were cleft with BamHI and NotI restriction enzymes (New England Biolabs, Ipswich, USA) and ligated to BamHI/NotI-linearized vector DNA using T4 DNA Ligase (New England Biolabs). Of note, PCR products obtained with primer combinations including a reverse primer with a stop codon (F1/R2) were inserted into plasmids pNG4110, and PCR products obtained with reverse primers lacking a stop codon (F1/R1) were inserted into plasmid pNG4210. The resulting plasmids were transferred to electrocompetent L. lactis PA1001 as described before³⁵ . All plasmids were verified by sequencing (Eurofins MWG Operon, Ebersberg, Germany).

Cell-free BAL specimens were stored at −80 °C until analyzed in batch. Microbial DNA was first extracted using the QIAGEN DNeasy PowerMax Soil kit following the manufacturer’s instructions. Then, PCR amplification was performed targeting the bacterial 16S rRNA gene V5-V6 region using primers 799F and 1115R [17 (link)]. We conducted PCR in a triplicate 25 μL mixture containing 5 μL 5× Phusion HF Buffer (Thermo Fisher Scientific, Frederick, MD, USA), 0.5 μL dNTPS (10 μmol/L each), 0.75 μL DMSO, 0.5 μL each primer (10 μmol/L), 0.25 μL Phusion Hot Start II polymerase (2 U/μL) (Thermo Fisher Scientific), 1 μL DNA template and 16.5 μL molecular-grade H₂O. PCR reactions were performed using the following condition: 30 s initial denaturation at 98 °C, followed by 35 cycles of 15 s at 98 °C, 30 s at 64 °C, and 30 s at 72 °C, with a final 10 min elongation at 72 °C. PCR products were first normalized using a SequalPrep Normalization kit (Thermo Fisher Scientific), then pooled and purified using AMPure (Beckman Coulter Life Sciences, Brea, CA, USA) to avoid contaminants. After that, we prepared the DNA library by mixing equimolar concentrations of DNA for each sample and sequenced the DNA using Illumina MiSeq reagent kit v3 (Illumina, Hayward, CA, USA) [8 (link)].

Mutant Kunjin viruses predicted to have defective sfRNA formation during infection were generated by overlap extension PCR. The FLSDX(pro)HDVr Kunjin virus infectious clone (provided by the Khromykh laboratory; described in Liu et al., 2003 (link)) was used as a PCR template for the construction of each mutant virus. The high fidelity Phusion Hot Start II polymerase (Thermo Scientific, Pittsburg, PA) was used for PCR using the mutagenic primers listed below and assembled PCR products were inserted into the Age1 and Xho1 restriction sites. Plasmids were screened for the proper mutations by sequencing PCR amplicons using the following primers: FLSDX Fw: 5′- actttgttaattgtaaataaatattgttat; FLSDX Rv: 5′-gcgtgggacgttgattcgcctttgt. Plasmids were linearized with Xho1 and in vitro transcriptions performed using the MEGAscript Sp6 transcription kit (Life Technologies, Foster City, CA) followed by Turbo DNase treatment to remove template. RNAs were phenol-chloroform-isoamyl alcohol (25:24:1) extracted and ethanol precipitation with ammonium acetate.

A MARS1 ‘midigene’ was generated by amplifying four different portions of this gene either from gDNA or cDNA using KOD Hot Start DNA Polymerase (Thermo Fisher Scientific) or Phusion Hotstart II polymerase (Thermo Fisher Scientific). In particular, the region spanning the promoter, the 5’UTR and the first 5 exons of this gene was amplified from gDNA using Phusion polymerase and the following primers: SR828 and SR818; the region spanning exon 5 to exon 15 was amplified from gDNA using KOD polymerase and the following primers: SR819 and HT7; the region spanning exon 15 to exon 28 was amplified from cDNA using KOD polymerase and the following primers: SR789 and SR797 and the 3’UTR was amplified from gDNA using KOD polymerase and the following primers: SR793 and SR829.
All PCR products were gel extracted and purified as described above in the section regarding the pPW3217 cloning. Next, these 4 PCR fragments were mixed with a purified and linearized and pRAM118/pPW3216 vector, previously digested by EcoRV and Not1, and incubated in presence of the In-Fusion reagents (Takara) as per manufacturer’s instructions. The resulting plasmid is notated as pPW3218. The sequence of the aforementioned primers can be found in Table 3.
The Phytozome v5.5 MARS1 transcript annotation is Cre16.g692228.t1.1.

RNA was extracted using the PicoPure RNA isolation Kit (Arcturus, Applied Biosystems, USA) from three pools each of 10 permethrin‐resistant females from Tororo in Uganda. The RNA was used to synthesize cDNA using SuperScript III (Invitrogen) with oligo‐dT20 and RNAse H (New England Biolabs). Full length coding sequences of CYP9K1 were amplified separately from cDNA of 10 mosquitoes using the Phusion HotStart II Polymerase (Thermo Fisher) (primers sequences: Table S1). The PCR mixes comprised of 5× Phusion HF Buffer (containing 1.5 mM MgCl₂), 85.7 µM dNTP mixes, 0.34 µM each of forward and reverse primers, 0.015 U of Phusion HotStart II DNA polymerase (Fermentas) and 10.71 µl of dH₂0, 1 µl cDNA to a total volume of 14 µl. Amplification was carried out using the following conditions: one cycle at 98°C for 1 min; 35 cycles each of 98°C for 20 s (denaturation), 60°C for 30 s (annealing), and extension at 72°C for 2 min; and one cycle at 72°C for 5 min (final elongation). PCR products were cleaned individually with QIAquick PCR Purification Kit (Qiagen) and cloned into pJET1.2/blunt cloning vector using the CloneJET PCR Cloning Kit (Fermentas). These were used to transform cloned E. coli DH5α, plasmids miniprepped with the QIAprep Spin Miniprep Kit (Qiagen) and sequenced on both strands using the pJET1.2F and R primers provided in the cloning kit.

Promoter libraries were cloned into the expression vector using ClaI and NheI restriction enzymes, aiming for at least 10× more colonies than unique promoters. To link barcodes and promoters, the promoter-BC fragment was amplified with primer DH.P39 (Supplemental Table S1) and one of the indexing primers containing the Illumina flow cell annealing sequences using Phusion Hot Start II polymerase (Thermo Fisher Scientific). PCR products were purified using AmPure XP beads (Beckman Coulter, #A63880) and directly sequenced using MiSeq 500- or 600-cycle kits (Illumina). The vector was cut with SphI and PacI or NheI, and a sequence containing a CpG-free eGFP and the annealing sequence for primer DH.P6 (Supplemental Table S1) was inserted. For an alternative construct, the insert contained a 31-bp minimal promoter in front of eGFP. RMCE was performed as described (Krebs et al. 2014 (link)).

Transcription of PunPgp-2 and PunPgp-9 was analysed by RT-PCR. Yeast were grown in induction media containing galactoses (SC-U medium but substituting the carbon source to 2% galactose and 1% raffinose) which induces activation of the GAL1 promotor and results in expression of the inserted gene. After 24 h of incubation at 30 °C and 250 rpm, total RNA was extracted using the Maxwell Simply RNA kit (Promega). cDNA was synthesized using the Maxima H- First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) from ~ 1 µg of RNA using Oligo(dT)₁₈Primers according to the manufacturer’s instructions. RT-PCR was performed using 0.02 U/µL Phusion Hot Start II polymerase (Thermo Fisher Scientific), 0.5 µM each primer, each dNTP at 200 μM, 1–2 ng/µL cDNA in a total volume of 25 µL 1 × HF buffer for two different primer sets (Primers in Supplementary Table S2). After a denaturation at 98 °C, 35 cycles of 98 °C for 10 s, a primer pair-specific annealing temperature for 15 s and 72 °C for 30 s were performed. Amplified PCR product were visualised after gel electrophoresis with GrGreen.