High prime

S. pombe cells grown in 5 ml YEAU overnight were harvest for genomic DNA extraction. EcoRI-digested genomic DNA was separated on 1% agarose gel and then transferred to N⁺ membrane (GE Healthcare) via capillary blot. The telomeric probe was prepared as previously described (Jun et al., 2013 (link)). The template of pol1⁺ was amplified with 5′ primer (GGTGCAGAAGACGGTCTGCAAG) and 3′ primer (CTTAGCATGCAGAAGCATGCGC), and the pol1⁺ probe was generated by High Prime (Roche). Southern blots were imaged using a Bio-Rad phosphorimager.

Testis extract preparation, immunoprecipitation, 3′ end radiolabeling detection, and Western blot analysis were performed as described with an anti-mouse SPO11 monoclonal antibody (S. Keeney) (Lange et al. 2011 (link)). Testes were pooled from two mice per Dnmt3L genotype at 18 dpp, while one Spo11^−/− 6-wk-old animal was used. Detection of TE sequences in SPO11 oligonucleotides was performed using the above immunoprecipitation protocol combined with a dot blot hybridization assay. To match testis weight input between genotypes, we used pooled testes from two Dnmt3L^+/+ and three Dnmt3L^−/− mice at 18 dpp as well as three Dnmt3L^+/+ mice at 12 dpp and five Dnmt3L^−/− at 13 dpp. Immunoprecipitates were digested with proteinase K and ethanol-precipitated to extract DNA. After Qubit quantification (Life Technologies), equal amounts of DNA were spotted onto a nylon membrane using a dot blot apparatus (Whatman). Hybridization was then sequentially performed with the full-length L1_spa element (Tf type) cloned into pTNC7 (Naas et al. 1998 (link)), a full-length IAPEz element amplified by PCR primers mapping to flanking sites (chromosome 3: 104,391,162–104,400,038) (Supplemental Table S2) and a major satellite DNA probe. Probes were labeled by random priming (High Prime, Roche) and [α-32P]-dCTP following the manufacturer's instructions.

The total RNA isolation and Northern blotting were performed as previously described (Boon and Koš, 2010 (link)). Briefly, total RNA from 0.2 ODs of cells (loading by OD units) was resolved on either 1% agarose or 6% denaturing polyacrylamide gels and transferred to a nylon membrane using wet electroblotting. The blots were hybridized with random primed [³²P]-labeled probes (High Prime, Roche) complementary to the HAS1 gene or [³²P]-labeled oligonucleotide complementary to the U3 snoRNA intron sequence (5′-AAGCTGCTGCAATGGTT-3′), 20S pre-rRNA (5′-CGGTTTTAATTGTCCTA-3′), 5S rRNA (5′-GATTGCAGCACCTGAGT-3′), or SCR1 RNA(5′-ATCCC­GGCCGCCTCCATCAC-3′) (Boon and Koš, 2010 (link)). The blots were exposed to phosphoimager plates and scanned on the FLA-7000 imager (Fuji).