Cd14 immunomagnetic beads

Five HD patients (mean age: 41.3 ± 5.3 years, dialysis age: 5-8 years) and three age-matched healthy subjects were recruited. PBMCs were isolated using ficoll-hypaque density gradient centrifugation. CD4+ T cells and monocytes were purified by positive selection with magnetic-activated cell separation CD4+ and CD14+ immunomagnetic beads (Miltenyi), respectively. RNA was extracted from CD4+ T cells and monocytes using RNAiso Plus, isopropanol, and chloroform, followed by reverse transcription using PrimeScript RT Master Mix (Takara, RR036A). The cDNA was then utilized in RT-qPCR. The primer sequences for the genes are as follows: AKT1 forward: CCGCTACTACGCCATGAAGATC, reverse: CGGTTCTCGGTGAGTGTGTG; JAK1 forward: CTGTCCTGGCCATCTCACAC, reverse: GGTGAGAAGGTTCCTCTGTCTG; PIK3CA forward: CACCTGAATAGGCAAGTCGAG, reverse: CCTGTAGAGCATCCATGAAATCTG; FOS forward: GGAGGGAGCTGACTGATACAC, reverse: AGCTGCCAGGATGAACTCTAG; JUN forward: GAGAGCGGACCTTATGGCTAC, reverse: GTGAGGAGGTCCGAGTTCTTG; mTOR forward: GAGAGGCCATCCGTGTGTTAG, reverse: ACTTGGATTCTGACAGGCTGAC; IFI30 forward: CCTGCGTGTTGGATGAACTTG, reverse: CAGGCATAGTGGCAGACTTCTC; HLA-DQA1 forward: GCTCTGACCACCGTGATGAG, reverse: GCAGTCTCCTTCCTCTCCAG; HLA-DQA2 forward: CTCTACCGCTGCCACCAATG, reverse: GCTCAGCCAGGTGATGTTGAC; HLA-DRB1 forward: CCTGACGCTGAGTACTGGAAC, reverse: CCGTAGTTGTGTCTGCAGTxAGG.

MDMs and dendritic cells (DCs) were obtained from peripheral blood mononuclear cells (PBMCs) through the centrifugation of buffy coats from healthy blood bank donors at the Instituto Nacional de Enfermedades Respiratorias under approbation of the Institutional Ethical Review Board (Protocol B14-19).
Heparinized blood was diluted 1:2 with RPMI 1640 layered on lymphocyte separation solution (Lonza) and centrifuged at 300× g for 45 min at room temperature. The PBMCs were harvested, and monocytes were positively selected using CD14⁺ immunomagnetic beads (Miltenyi Biotec, Auburn, CA, USA) according to the manufacturer’s instructions. For MDM differentiation, monocytes were cultured with GM-CFS (10 ng/mL) on days 1, 3, and 5. For DCs differentiation, monocytes were cultured with GM-CSF (50 ng/mL) and IL-4 (25 ng/mL) on days 1 and 4 until day 5, when immature DCs (iDC) were obtained (At this point, the cells had acquired macrophage or dendritic cell morphology and called MDMs or DCs, respectively.

The PDAC cell lines Capan-2 and Aspc-1 were obtained from the American Type Culture Collection (ATCC). Cells were grown in DMEM medium (Gibco, Life Technologies, Carlsbad, CA) supplemented with 10% (v/v) fetal bovine serum (FBS) (Gibco) at 37°C in 5% CO2 incubator. Cells were grown in monolayer and passaged routinely 2-3 times a week. All cell lines were validated by STR fingerprinting and were routinely screened for mycoplasma. Peripheral blood mononuclear cell (PBMC) from the buffy coats of healthy donors (the Renji Hospital) was obtained by density gradient centrifugation with lymphocyte isolation solution (Qiagen). Monocytes were isolated from PBMC cells by positive magnetic separation using CD14 immunomagnetic beads (Miltenyi Biotec, Bergisch, Germany). CD14+ cells (10⁶/mL) were cultured in 1640 media with 10% FBS in 48-well flat-bottom culture plates. The adherent monocytes were incubated for 7 days in RPMI-1640 medium supplemented with 50 ng/mL of M-CSF (Peprotech Inc., Rocky Hill, NJ, USA) to become macrophages. The fresh growth media with same concentration of M-CSF was replaced every 2 days for a total of 7 days.

Human peripheral blood CD14⁺ monocytes were isolated using CD14⁺ immunomagnetic beads (Miltenyi Biotec, Bergisch-Gladbach, Germany) and then cultured for 5 days in complete medium containing 100 ng/mL of recombinant human granulocyte-macrophage colony stimulating factor (rhGM-CSF; PeproTech, Inc., Rocky Hill, NJ, USA) and 50 ng/mL of recombinant human interleukin 4 (rhIL4; PeproTech). Human CD4⁺ T cells were isolated from peripheral blood monocytes by positive selection with CD4⁺ immunomagnetic beads (Miltenyi Biotec). Primary HUVECs were purchased from ScienCell Research Laboratories (Carlsbad, CA, USA), cultured in endothelial cell medium (ScienCell), and maintained at 37 °C under 5% CO₂ in a humidified incubator. The growth medium was changed every 2 days.

PBMCs were thawed and CD14⁺ cells were isolated from PBMCs using CD14 immunomagnetic beads (Miltenyi Biotec, Shanghai, China). Then the cells were cultured in RPMI 1640 medium (Gibco) supplemented with 5% AB human sera, 10 ng/mL interleukin-4, and 20 ng/mL granulocyte-macrophage colony-stimulating factor (GM-CSF) at 37°C in a 5% CO₂ incubator. On day 6, dendritic cells (DCs) were harvested and pulsed with immundominant peptides, rLpp20, HP-WCL, and bovine serum albumin (BSA) as a negative control at a final concentration of 50 μg/mL for 24 h. Then, DCs and epitope-specific T cells were co-cultured at a ratio of 1:10 for 5 h in the presence of monensin.