Plko 1

Manufactured by Genechem

Sourced in China

The PLKO.1 is a versatile laboratory equipment designed for routine cell culture and molecular biology applications. It provides a controlled environment for cell growth and manipulation, with precise temperature, humidity, and CO2 regulation capabilities. The PLKO.1 is a reliable and efficient tool for researchers and scientists in various fields.

Automatically generated - may contain errors

Lab products found in correlation

Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions) Lipofectamine, by Thermo Fisher Scientific (1 mentions) Ges 1, by National Collection of Authenticated Cell Cultures (1 mentions) Puromycin, by Thermo Fisher Scientific (1 mentions) Plvx lentiviral vector, by Addgene (1 mentions) Turbofect transfection, by Thermo Fisher Scientific (1 mentions) Scramble control, by Genechem (1 mentions)

Close spelling variants of this product

PLKO.1-EGFP-puromycin (3 citations)

6 protocols using plko 1

Modulation of NORAD and NRP1 in Gastric Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

Stomach adenocarcinoma cell lines MGC-803 and MKN-28, and Human gastric mucosal cells GES-1 were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China), and were incubated at 37 °C in DMEM (Gibco, Thermo Fisher Scientific, Inc., Jiangsu, China) with 10% FBS (cat. no. 12483020, Gibco, Thermo Fisher Scientific, Inc., Jiangsu, China).
The pcDNA-NORAD, pcDNA-NRP1, miR-378c-mimics, and miR-378c-inhibitors were obtained from Genomeditech (Shanghai, China), and NORAD or NRP1 shRNA was inserted into the lentiviral vector pLKO.1 (Genechem, Shanghai, China) to knock down NORAD or NRP1. Then, they were transfected into MGC-803 and MKN-28 cells based on the protocols of lipofectamine (11668-019, Invitrogen, USA).

Hu Y, & Luo M. (2022). NORAD-sponged miR-378c alleviates malignant behaviors of stomach adenocarcinoma via targeting NRP1. Cancer Cell International, 22, 79.

+ Open protocol

+ Expand

Overexpression and Knockdown of Key Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA of HUVEC was used as a template to amplify the full-length open reading frames of MIST1 and SNAI1 by PCR, which were cloned in the expression vector pcDNA3.1 (cat. no. V79020; Invitrogen; Thermo Fisher Scientific, Inc.). pLKO.1 containing small hairpin (sh)RNAs specifically targeting MIST1, SNAI1 and PTEN (Shanghai GeneChem Co., Ltd., Shanghai, China) were used to knockdown these genes in the cell lines. The shRNAs had the following sequences: shRNA-1 targeting MIST1, 5′-CCGGCCAAGGGTCTGCGGAGC-3′; shRNA-2 targeting MIST1, 5′-CCATGTCCAGCAGCCGCCTCC-3′; shRNA-1 targeting SNAI1, 5′-TTTACCTTCCAGCAGCCCTAC-3′; shRNA-2 targeting SNAI1, 5′-ACCTCAGCCTGGGTGCCCTCA-3′; shRNA-1 targeting PTEN, 5′-AGAGTTGCACAATATCCTTTT-3′; shRNA-2 targeting PTEN, 5′-GAGGAAACCTCAGAAAAAGTA-3′. A 293T cell lentiviral packaging system was used. A total of 2.5 µg Rev, 3 µg Rev, 3,5 µg Rev and 12 µg target plasmid were transfected into 293T cells in a 10 cm cell culture dish with polyethyleneimine (cat. no. B600070; ProteinTech Group, Inc., Chicago, IL, USA) at a concentration of 1.7 µg/µl. After 4 h of transfection, the medium was changed to complete medium to collect the virus. The collected virus infected the target cells 3 times for 8 h each.

Lee Y., Yao W., Yang C., Li Y., Ni H., Wang L., Ji B., Gu Y, & Yang S. (2018). MIST1 regulates SNAI1 and acts through the PTEN/AKT signaling axis to promote anoikisresistance in human melanoma cells. Experimental and Therapeutic Medicine, 16(2), 695-703.

+ Open protocol

+ Expand

Establishing Stable USP21 Knockdown Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentiviruses carrying shRNA targeting human USP21 lentiviral vectors (PLKO.1) were from GeneChem (Shanghai, China). Lentiviruses containing overexpressing lentiviral vectors were constructed and packaged using standard procedures. Subsequent lentiviral infections were performed in the presence of Polybrene. After 48 h, cells were cultured in medium containing puromycin for the selection of stable clones. The levels of UPS21 expression in stable clones were then verified by real-time PCR or Western blot.

Li W., Cui K., Prochownik E.V, & Li Y. (2018). The deubiquitinase USP21 stabilizes MEK2 to promote tumor growth. Cell Death & Disease, 9(5), 482.

+ Open protocol

+ Expand

Lentiviral Overexpression and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

LncRNA‐HIT cDNA was cloned into the pLVX lentiviral vector (Addgene, Cambridge, MA). Virus was made using Turbofect transfection (Thermo, Boston, MA) into 293T cells. Virus was filtered and then infected into cells with polybrene for 24 h. Cells were selected with 3 μg/mL puromycin (Invitrogen, Carlsbad, CA). The pLKO.1 shRNA lentiviral system was used to knockdown genes of interest. pLKO.1, pLKO.1‐shHIT‐1, and pLKO.1‐shHIT‐2 were purchased from Genechem Company, Shanghai, China. Target sequences for shRNAs are as follows: shHIT‐1: GTCTCACATACCTTCCTAACTCTAG, shHIT‐2: CCTCCAAGGTGGTCTGTGACCTTAA. puromycin at 3 μg/mLwas used to select stable cells.

Jia X., Wang Z., Qiu L., Yang Y., Wang Y., Chen Z., Liu Z, & Yu L. (2016). Upregulation of LncRNA‐HIT promotes migration and invasion of non‐small cell lung cancer cells by association with ZEB1. Cancer Medicine, 5(12), 3555-3563.

+ Open protocol

+ Expand

Knockdown of Tau protein in cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The shTau-1 target sequence was 5′-GACGCTG-GCCTGAAAGAATCT-3′, the shTau-2 was 5′-GATGCTAAGAGCACTCCAACA-3′, and the shTau-3 was 5′-GATTTCCTCTCCAAAGTTTCC-3′, and these were cloned in pLKO.1 (Genechem, Shanghai, People’s Republic of China). Scramble control (5′-CCTAAGGTTAAGTCGCCCTCG-3′) was also purchased from Genechem. Retro-viral and lentiviral particles were produced by transfecting prostate cancer cells with the appropriate expression and packaging plasmids using Lentiviral Packaging Systems (Genechem) and filtering cultured supernatants through a 0.45-μM filter.

Yang J., Yu Y., Liu W., Li Z., Wei Z, & Jiang R. (2017). Microtubule-associated protein tau is associated with the resistance to docetaxel in prostate cancer cell lines. Research and Reports in Urology, 9, 71-77.

+ Open protocol

+ Expand

Silencing IGF2BP3 in Glioma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human glioma U87 and U251 cells were provided by the National Collection of Authenticated Cell Cultures (China). The short-hairpin RNAs (shRNAs) for human IGF2BP3 (sh1-sequence, CGGTGAATGAACTTCAGAATT; sh2-sequence, GCAGTTGTAAATGTAACCTAT) were synthesized by Genechem (China) and packaged into pLKO.1 (lentiviral vector) to generate pLKO.1-shIGF2BP3 silencing constructs, with the empty vector serving as the negative control (NC). Puromycin was used to select the cells with stable transduction, and transduction efficiency was reflected by green fluorescent protein expression. The transfection was performed as directed by the manufacturer. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) and immunoblot were conducted to confirm the knockdown of IGF2BP3.

Zheng X., Li S., Yu J., Dai C., Yan S., Chen G, & Sun C. (2023). N6-methyladenosine reader IGF2BP3 as a prognostic Biomarker contribute to malignant progression of glioma. Translational Cancer Research, 12(4), 992-1005.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!