Acetyl α tubulin lys40

Manufactured by Cell Signaling Technology

Sourced in United States

Acetyl α-Tubulin (Lys40) is an antibody used for the detection of acetylated α-Tubulin at lysine 40. Acetylation of α-Tubulin is a post-translational modification that plays a role in the regulation of microtubule dynamics and stability.

Automatically generated - may contain errors

Lab products found in correlation

7 protocols using acetyl α tubulin lys40

Investigating Anti-Fibrotic Mechanisms

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tubastatin A was purchased from Selleckchem (Houston, TX, United States). Antibodies to HDAC6 (#7612), Acetyl Histone H3 (Lys9) (#9649), Histone H3 (#9717), Acetyl α-Tubulin (Lys40) (#5335), α-Tubulin (#3873), Smad3 (#9523), p-Smad3 (#9520), TAK1 (#5206), p-TAK1 (#9339), Snail (#3879), PI3K (#4257), p-PI3K (#17366), AKT (#4691), p-AKT (#4060), STAT3 (#9139), p-STAT3 (#9138), CTGF (#86641), E-cadherin (#14472), STAT6 (#5397) and p-STAT6 (#56554) were purchased from Cell Signaling Technology (Danvers, MA, United States). Antibodies to Fibronectin (ab2413), MMP2 (ab37150), MMP9 (ab38898) were purchased from Abcam (Cambridge, MA). Antibody to Twist (A3237) was purchased from ABclonal (Wuhan, China). Antibodies to GAPDH (sc-32233), Collagen I (A2) (sc-28654), CD68 (sc-20060), TGFβRI (sc-399) were purchased from Santa Cruz Biotechnology (San Diego, CA, United States). Antibodies to Arginase-1 (GB11285) and CD163 (GB11340) were purchased from Servicebio (Wuhan, China). IL-4 protein was purchased from R&D Systems (Minneapolis, MN, United States). Peritoneal dialysate was purchased from Baxter Healthcare (Guangzhou, China). Antibody to α-SMA (A2547), chlorhexidine gluconate (C9394) and all other chemicals were obtained from Sigma-Aldrich (St. Louis, MO, United States).

Shi Y., Li J., Chen H., Hu Y., Tang L., Zhou X., Tao M., Lv Z., Chen S., Qiu A, & Liu N. (2022). Pharmacologic Inhibition of Histone Deacetylase 6 Prevents the Progression of Chlorhexidine Gluconate-Induced Peritoneal Fibrosis by Blockade of M2 Macrophage Polarization. Frontiers in Immunology, 13, 899140.

+ Open protocol

+ Expand

Evaluating HDAC6 Inhibitor Tubastatin A

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tubastatin A was purchased from Selleckchem (Houston, TX, USA). Antibodies to p-STAT3 (Tyr-705), STAT3, p-Smad3 (Ser423/425), Smad3, p-EGFR (Tyr1068), p-NF-κB (Ser536), NF-κB, Histone H3, Acetyl Histone H3 (Lys9), Acetyl α-tubulin (Lys40) and HDAC6 were purchased from Cell Signaling Technologies (Danvers, MA, USA). Antibodies to collagen I (A2), E-cadherin, TGF-βRI, CD68, EGFR, VEGF, CD31 and GAPDH (glyceraldehyde 3-phosphate dehydrogenase) as well as HDAC6 siRNA were purchased from Santa Cruz Biotechnology (San Diego, CA, USA). Antibody to β-actin was purchased from TransGen Biotech (Beijing, China). TNF-α, IL-1β, TGF-β1, MCP-1, IL-6 and TGF-β1 enzyme-linked immunosorbent assay (ELISA) kits were from R&D Systems (Minneapolis, MN, USA). α-SMA, DMSO and other chemicals were obtained from Sigma-Aldrich (St. Louis, MO, USA).

Xu L., Liu N., Gu H., Wang H., Shi Y., Ma X., Ma S., Ni J., Tao M., Qiu A, & Zhuang S. (2017). Histone deacetylase 6 inhibition counteracts the epithelial–mesenchymal transition of peritoneal mesothelial cells and prevents peritoneal fibrosis. Oncotarget, 8(51), 88730-88750.

+ Open protocol

+ Expand

Investigating Inflammatory Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

β-actin (Cat#5125), GAPDH (Cat#8884), IRF-1 (Cat#8478), iNOS (Cat#13120), p-STAT1(Y701) (Cat#7649), STAT1 (Cat#9172) and acetyl-α-tubulin (Lys40) (Cat#5335), HDAC6 (Cat#7612) antibodies were purchased from Cell Signaling Technology (Danvers, Massachusetts). Lipopolysaccharide (LPS) from Escherichia coli 0111:B4 (Cat# L4391) was purchased from Sigma Aldrich (St. Louis, Missouri). CAY10603 (Cat# S7596) was obtained from Selleck Chemicals (Houston, Texas).

Wang Y., Wang K, & Fu J. (2020). HDAC6 Mediates Macrophage iNOS Expression and Excessive Nitric Oxide Production in the Blood During Endotoxemia. Frontiers in Immunology, 11, 1893.

+ Open protocol

+ Expand

Signaling Pathway Protein Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

GSK-3β (Cat#12456), β-actin (Cat#5125), GAPDH (Cat#8884), AKT (Cat#4691), TBK1 (Cat#3504), phospho-TBK1 (Ser172) (Cat#5483), phospho-AKT (ser473) (Cat#4060), HDAC6 (Cat#7612), phospho-GSK3β (Cat#9323), and acetyl-α-tubulin (Lys40) (Cat#5335) antibodies were purchased from Cell Signaling Technology (Danvers, Massachusetts). Poly (I:C) was purchased from Sigma Aldrich (Cat#P9582; St. Louis, Missouri). M-CSF was obtained from R&D Systems (Cat#416-ML; Minneapolis, Minnesota).

Wang Y., Wang K, & Fu J. (2020). HDAC6 Mediates Poly (I:C)-Induced TBK1 and Akt Phosphorylation in Macrophages. Frontiers in Immunology, 11, 1776.

+ Open protocol

+ Expand

Immunofluorescence Staining of Microtubules

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were plated at 100,000 cells/well in a 4-chamber tissue culture treated glass slide (Falcon). Cells were fixed in 4% paraformaldehyde for 10 min at room temperature. Cells were then washed with PBS 3-times and permeabilized with 0.05% Triton-X100 for 10 minutes at room temperature. Following permeabilization, the cells were washed with PBS 3-times and blocked for 1hr at room temperature using 3% BSA in PBS. After blocking the cells were incubated with primary antibody (Acetyl-α-tubulin (Lys40) (1:200) (Cell Signaling Technology) or α-tubulin (1:50) (Cell Signaling Technology) overnight at 4°C. After primary antibody incubation, the cells were washed with PBS-3 times for five minutes each and incubated with secondary anti-rabbit-AF-488 antibody (1:100) (Cell Signaling Technology) in 3% BSA in PBS for 1hr at room temperature. Cells were then washed with PBS 4-times at 5-minute intervals and mounted using Prolong Diamond Antifade with DAPI (Life Technologies). 20× stitch imaging was done with Leica DMI6000B inverted fluorescent microscope (Leica Microsystems Inc.) using MetaMorph imaging software version 7.8 (Molecular Devices). 100× images were acquired using Leica DM6000B upright fluorescent microscope using Velocity software.

Nagaraj A.B., Kovalenko O., Avelar R., Joseph P., Brown A., Surti A., Mantilla S, & DiFeo A. (2018). Mitotic Exit dysfunction through the deregulation of APC/C characterizes cisplatin resistant state in epithelial ovarian cancer. Clinical cancer research : an official journal of the American Association for Cancer Research, 24(18), 4588-4601.

+ Open protocol

+ Expand

Acetylation and Ubiquitination Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antibodies against HDAC6 (#7558), acetylated lysine (Ace‐K, #9441), SIRT3 (#2627), endothelial nitric oxide synthase (eNOS, #32027), phospho‐eNOS (Ser1177, #9571) and acetyl‐α‐tubulin (Lys40, #12152) were obtained from Cell Signaling Technology (Danvers, MA, USA). Myc (#sc‐40), β‐actin (#sc‐1616) and CSE (#sc‐374249) antibodies were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Antibodies to HA (#MMS‐101R, Covance, Princeton, NJ, USA), FLAG (#F1804, Sigma‐Aldrich), α‐tubulin (#T5168, Sigma‐Aldrich) and CSE (#12217‐1‐AP, ProteinTech, Rosemont, IL, USA) were commercially purchased. Expression plasmids pcDNA‐HDAC6‐FLAG (#30482), pcDNA‐HDAC6.DC‐FLAG (#30483), pcDNA3.1‐SIRT3‐FLAG (#13814) and pRK5‐HA‐ubiquitin (#17608) were obtained from Addgene (Cambridge, MA, USA). The CSE‐Myc plasmid (#RC231191) was purchased from OriGene Technologies (Rockville, MD, USA). The K73R mutation in the CSE‐Myc template was generated using forward (5′‐GGAATTGCCTTGAAAGAGCAGTGGCAGCACTGG‐3′) and reverse (5′‐CCAGTGCTGCCACTGCTCTTTCAAGGCAATTCC‐3′) primers from Bioneer (Daejeon, Republic of Korea) and the QuikChange II Site‐Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA) according to manufacturer protocol. All plasmids were purified using an EndoFree Plasmid Maxi Kit (Qiagen, Valencia, CA, USA).

Chi Z., Le T.P., Lee S.K., Guo E., Kim D., Lee S., Seo S., Lee S.Y., Kim J.H, & Lee S.Y. (2020). Honokiol ameliorates angiotensin II‐induced hypertension and endothelial dysfunction by inhibiting HDAC6‐mediated cystathionine γ‐lyase degradation. Journal of Cellular and Molecular Medicine, 24(18), 10663-10676.

+ Open protocol

+ Expand

Molecular Mechanisms of HDAC6-Mediated Fibrosis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tubastatin A and MG132 were purchased from Selleckchem (Houston, TX, United States). Antibodies to HDAC6 (#7612), Acetyl Histone H3 (Lys9) (#9649), Histone H3 (#9717), Acetyl α-Tubulin (Lys40) (#5335), α-Tubulin (#3873), ZO-1 (#13663), Smad3 (#9523), p-Smad3 (#9520), JAK2 (#3230), p-JAK2 (#3771), STAT3 (#9139), p-STAT3 (#9138), CTGF (#86641), E-cadherin (#14472), Cyclin E (#20808) and Snail (#3879) were purchased from Cell Signaling Technology (Danvers, MA, United States). Antibody to Fibronectin (ab2413) was purchased from Abcam (Cambridge, MA). Antibodies to GAPDH (sc-32233), Collagen I (A2) (sc-28654), TGFβRI (sc-399), Smad7 (sc-365846), and PCNA (sc-71858) were purchased from Santa Cruz Biotechnology (San Diego, CA, United States). IL-6 protein was purchased from R&D Systems (Minneapolis, MN, United States). HDAC6 siRNA was purchased from GenePharma (Shanghai, China). Lipofectamine 2000 was purchased from Invitrogen (Grand Island, NY, United States). The Cell Counting Kit-8 (CCK-8) proliferation assay kit was purchased from Beyotime Biotechnology (Haimen, China). Antibody to α-SMA (A2547) and all other chemicals were obtained from Sigma-Aldrich (St. Louis, MO, United States).

Shi Y., Tao M., Ni J., Tang L., Liu F., Chen H., Ma X., Hu Y., Zhou X., Qiu A., Zhuang S, & Liu N. (2021). Requirement of Histone Deacetylase 6 for Interleukin-6 Induced Epithelial-Mesenchymal Transition, Proliferation, and Migration of Peritoneal Mesothelial Cells. Frontiers in Pharmacology, 12, 722638.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!