Templiphi dna amplification kit

Head-to-tail dimer constructs of the seven satellites mentioned above were produced essentially as described by Ferreira et al.47 (link). Satellites were PCR amplified using primers MA1386/MA1387 (CCTTAGCTTCGCACGTAGCT/CTGCTTAGCGTAGCGGTTTGG). Amplified products of ~700 bp were purified, self-ligated and then amplified by rolling-circle amplification (RCA; TempliPhi DNA Amplification Kit, GE Healthcare, Little Chalfont, UK). RCA product was partially digested with PstI. Satellite dimers (~1400 bp) were excised from agarose gels and ligated in pCAMBIA0380 (Cambia, Canberra, Australia). Constructs were confirmed by restriction with BamHI, HindIII, and sequencing. Dimeric constructs will henceforth be identified by the prefix DIM.

Cotton plants (Gossypium hirsutum) showing typical leaf curling, vein thickening and enation on the abaxial side of leaf were collected from a field in Lucknow, U. P., India (26° 50′ 49.2″ N, 80° 56′ 49.2″ E). The leaf sample of the diseased cotton plant was collected from a private land with the verbal consent of the owner to pick the leaf sample for academic purpose (Gossypium hirsutum is not an endangered or protected species), in September of 2010. Total genomic DNA from diseased cotton leaf was isolated using DNAeasy plant mini kit (QIAGEN, Germany) following the manufacturer’s instructions. Begomoviral complex was confirmed as described by Kumar et al. [30 (link)]. Full-length genome of CLCuBuV was amplified using templiPhi DNA amplification kit (GE healthcare, USA) as per manufacturer’s instructions. The RCA (rolling circle amplification) product was partially digested with 1 U of HindIII restriction enzyme (Fermentas, USA) and incubated at 37°C for 25 min. The purified DNA fragment was ligated into pBluscriptSK+ vector and transformed into Escherichia coli DH5α cells. The clone was sequenced by automated sequencer (Ocimum Biosolutions Ltd., India) and the nucleotide sequence was submitted in GenBank under the accession number KF767352. Genome organization of DNA-A component of CLCuBuV is represented in Fig. 1A.

We surveyed the cowpea crops for yellow mosaic symptoms at the vegetative growth stage in five states of India, namely, Jharkhand, Chhattisgarh, Uttar Pradesh, Madhya Pradesh and Assam, during 2012–13 [43 –44 ]. The maximum incidence of this viral disease was in a field of Jharkhand state, with a disease incidence of about 60–70%. The cowpea plants in the field exhibited stunted growth, yellow patches, mottling of leaves, reduced leaf size and distortion of leaf lamina symptoms (S1 Fig). The infected plant leaf materials were RCA analyzed, cloned and sequenced. Agroinfectious dimeric clones were prepared for MYMIV cowpea isolate, propagated and maintained in cowpea cultivar Pusa Komal through agroinfiltration and maintained in a greenhouse at 25–27°C. Total genomic DNA was extracted from infected leaf samples by using DNA isolation kit (Hi-Media, Mumbai), the purified genomic DNA were subjected to amplify full length of DNA-A and DNA-B, using TempliPhi^™ DNA-Amplification kit (GE Healthcare, UK) through Rolling circle amplification (RCA) method as per manufacturer’s instructions. The ~2.7 Kb DNA fragments obtained after the restriction digestion (EcoRI, HindIII, BamHI, SacI and EcoRV) of the RCA products were cloned and sequenced. The sequences obtained were analyzed using DNA Star, Mega 5.2, and BIOEDIT version 7.0 programs.

Total genomic DNA was subjected to RCA using TempliPhi DNA amplification kit (GE Healthcare, UK). The RCA products served as the templates for amplification of the virus DNA and betasatellite employing primers specific for the CLCuMuV-CP gene and betasatellite (Supplementary Table T1). The PCR parameters remained same as described above.

Leaves were collected from cotton plants exhibiting CLCuD symptoms at the experimental fields of Central Institute for Cotton Research (CICR Regional Station, 29.54°N 75.04°E), Sirsa, Haryana (20 samples) and from JMI (28.56°N 77.28°E), New Delhi (5 samples) between 2013 and 2015 every year during the months of October. The total genomic DNA from the diseased leaves was isolated employing DNAeasy plant mini kit (QIAGEN, Germany). It was subjected to RCA to amplify full-length genomes of BAC with the help of templiphi DNA amplification kit (GE Healthcare, USA).The concentration of DNA was estimated by Biophotometer plus (Eppendorf, Germany). Presence of the BAC was confirmed following PCR-based amplification of the CP gene using RCA product as template employing oligo primers viz. P1 (5′GGGATTTGATTTCAGTAATAAGG 3′) and P2 (5´ GAGCATGTTGTATATGTAGACCA 3´) specific for the CP gene of BAC [14 (link)].

AbMV circular DNA molecules in TNA samples (2.3) served as templates for RCA via a TempliPhi DNA amplification kit (GE Healthcare/Amersham Biosciences, Uppsala, Sweden) as described previously (Kleinow et al., 2009b (link); Jeske, 2018 (link)). The presence of the desired AbMV variants in the products was confirmed by RFLP analysis using MP mutant-specific restriction enzymes (Alw NI, Blp I or Pvu II) combined with Bam HI (Figure 1)(Kleinow et al., 2009b (link)). Additionally, the integrity of each DNA-B encoded MP version was verified by direct sequencing of the RCA products (Schubert et al., 2007 (link)).