ZEN-4::GFP was amplified from bsem1129 (35 (link)) with zen-4_uni_5′_nested_2_attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT GCAAAAAGTCGCATCTGGGAA; attB1 underlined) and unc-54_3′UTR_Hobert_nested_3′_attB2 (GGAAACAGTTATGTTTGGTATATTGGGACCCAGCTTTCTTGTACAAAGTGGTCCCC ; attB2 underlined) primers using TaKaRa PrimeSTAR (35 (link)). The resulting attB-flanked PCR product was recombined into pCFJ151 (Addgene) using Gateway BP Clonase II (Invitrogen/Thermo Fisher Scientific) to create bsem1267. SM2333 was generated by injecting bsem1267 along with pCFJ601, pMA122, pGH8, pCFJ90, and pCFJ104 (all available from Addgene) into SM2288 [ttTiS605 II; unc-119(ed3)III]. The mosSCI protocol on www.wormbuilder.org was used to generate single integrants. SM2333 was used as an on-slide WT control in antibody stains.
Pma122
Manufactured by Addgene
The PMA122 is a laboratory equipment product. It is a multi-channel pipette designed for precise liquid handling in various scientific applications. The PMA122 allows for the simultaneous transfer of multiple liquid samples with adjustable volume settings.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using pma122
1
GFP Tagging of Zen-4 Protein in C. elegans
2
MosSCI Integration of Fluorescent Reporters
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
csr-1 mCherry and GFP promoter fusions were integrated by Mos-mediated single-copy transgene insertion (MosSCI)29 (link). For the MosSCI insertions of promoter-fused GFP and mCherry, we amplified csr-1a and csr-1b endogenous promoters, the mCherry and GFP genes, and the csr-1 3′UTR using the primers listed in Supplementary Data 5 . Plasmids were assembled by isothermal cloning61 (link). For MosSCI injections, we integrated transgenes into the ttTi5605 MosI site in strain EG4322 (Ch. II) following a published MosSCI protocol29 (link). Injection mixes contained 50 ng/μl MosSCI-targeting vector, 50 ng/μl eft-3p::Mos1 transposase (pCFJ601, Addgene #34874), 10 ng/μl rab-3p::mCherry (pGH8, Addgene #19359), 2.5 ng/μl myo-2p::mCherry (pCFJ90, Addgene #19327), 5 ng/μl myo-3p::mCherry (pCFJ104, Addgene #19328), and 10 ng/μl hsp-16.1::peel-1negative selection (pMA122, Addgene #34873)29 (link).
3
Construction of Inducible Cas9 System
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Strains generated for this publication along with key plasmids and reagents are listed in the Key Resources Table. A full list of all plasmids is given in Supplementary file 1 . All plasmids were cloned by Gibson Assembly following the standard NEB Builder HiFi DNA Assembly master mix protocol (New England Bio Labs [NEB], MA), unless otherwise indicated. All plasmids have been confirmed by restriction digest, Sanger sequencing, and/or full plasmid sequencing. All primers used in the construction and validation of plasmids are listed in Supplementary file 2 .
To generate our heatshock-inducible Cas9, hsp16.41p::Cas9dpiRNA::tbb-2 ′3UTR, the hsp16.41 promoter was amplified from pMA122 (Addgene ID34873) (Frøkjær-Jensen et al., 2012 (link)). The germline-licensed Cas9 and tbb-2 3′ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al., 2018 (link)). All fragments were assembled into PCR-linearized pUC19 vector (NEB) to give the final plasmid pZCS36.
To generate a standard empty guide vector, U6p::(empty)gRNA, the U6p and gRNA scaffold from pDD162 (Addgene ID47549) (Dickinson et al., 2015 (link)) was amplified and assembled into PCR-linearized pUC19 to generate pZCS11.
To generate rsp-27p::NeoR::unc-54 3′ UTR, the full resistance cassette was amplified from pCFJ910 (Addgene ID44481) and assembled into PCR-linearized pUC19 vector to give pZCS38.
To generate our heatshock-inducible Cas9, hsp16.41p::Cas9dpiRNA::tbb-2 ′3UTR, the hsp16.41 promoter was amplified from pMA122 (Addgene ID34873) (Frøkjær-Jensen et al., 2012 (link)). The germline-licensed Cas9 and tbb-2 3′ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al., 2018 (link)). All fragments were assembled into PCR-linearized pUC19 vector (NEB) to give the final plasmid pZCS36.
To generate a standard empty guide vector, U6p::(empty)gRNA, the U6p and gRNA scaffold from pDD162 (Addgene ID47549) (Dickinson et al., 2015 (link)) was amplified and assembled into PCR-linearized pUC19 to generate pZCS11.
To generate rsp-27p::NeoR::unc-54 3′ UTR, the full resistance cassette was amplified from pCFJ910 (Addgene ID44481) and assembled into PCR-linearized pUC19 vector to give pZCS38.
4
Transgenic C. elegans Strain Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C. elegans was maintained according to standard procedures (Stiernagle, 2006) (link). Transgenic worm lines were generated using the MosSCI transgenesis method according to published protocols (http://www.worm-builder.org/). Briefly, the expression vectors for 1) Dendra2-H2B (25 ng/ ml); 2) the Mos recombinase (pCFJ601, 50 ng/ml, Addgene # 34874); 3) the co-injection markers (pCFJ90, 1.5 ng/ml, Addgene # 19327; pCFJ104, 7.8 ng/ml, Addgene # 19328; pGH8, 7.2 ng/ml, Addgene # 19359); and 4) a heat shock-inducible negative selection marker (pMA122, 10 ng/ml, Addgene # 34873) were microinjected in L4 and young adult Unc-worms from the EG6699 Mos1 insertion strain. All Addgene plasmids were gifts from Erik Jorgensen (Frokjaer-Jensen et al., 2008) . After injection, worms were maintained at 25°C on OP50. Heat-shock was performed at 34°C for 2 hours ~10 days after injection. Unc+Cherry-worms were screened for the presence of a Dendra2-H2B signal in the gonads on an inverted microscope. The resulting transgenic strain was extensively characterized by PCR to ascertain insertion site. Homozygotes arose spontaneously and were backcrossed twice with the wild type N2 strain. The resulting strain is referred to as JBL1 [Pmex-5::Dendra2::his-66::tbb-2 3´UTR]. JBL1 was crossed with TH27 [tbg-1::gfp] or JH2108 [Pie-1p::gfp::pgl-1::pgl-1 3´UTR] to obtain strains JBL2 and JBL3, respectively.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!