RNA purification was carried out on FACS sorted day 7 bone marrow stromal cultures according to the manufacturer’s recommendations (Macherey-Nagel and Zymo Research). cDNA was prepared from 500 ng of RNA/sample using the SuperScript II Reverse Transcriptase kit or Protoscript II kit (Life Technologies, NEB). QPCR was carried out using I-Taq Universal SybrGreen Supermix (Bio-Rad) in a Bio-Rad CFX real-time thermocycler. PCR primer sequences used for gene expression analyses and RNA-Seq validation are listed in Supplementary Table 4 .
Cfx real time thermocycler
Manufactured by Bio-Rad
Sourced in United States
The CFX Real Time thermocycler is a laboratory instrument designed for the amplification and detection of nucleic acid sequences in real-time. It is capable of performing polymerase chain reaction (PCR) and quantitative PCR (qPCR) analyses.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green fluorophore, by Thermo Fisher Scientific (3 mentions)
Superscript 2 reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions)
Itaq universal sybr green supermix, by Bio-Rad (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Direct zol rna isolation kit, by Zymo Research (1 mentions)
Anchored oligo dt, by Thermo Fisher Scientific (1 mentions)
Forward and reverse primer, by Merck Group (1 mentions)
Sybr green jumpstart taq readymix, by Merck Group (1 mentions)
Revertaid reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
7 protocols using cfx real time thermocycler
1
Bone Marrow Stromal Cell RNA Purification and Analysis
2
qPCR Gene Expression Analysis
3
Quantitative PCR Assay for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription (RT) was performed using the RevertAid Reverse Transcription kit (Thermo Scientific) with Anchored oligo (dT) (Thermo Scientific) and dNTPs to generate cDNA from 1 μg of RNA. Real‐time qPCR was performed using the SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma), 0.5 μM forward and reverse primers (Sigma) on the CFX Real Time Thermocycler (Bio‐Rad, Hercules, CA). Cycling conditions were 95°C for 2 min, followed by 40 cycles of 95°C for 15 s, 67°C for 30 s and 72°C for 30 s for IDO; RPLPO and 35 cycles of 95°C for 20 s, 65°C for 30 s, and 72°C for 30 s for SOCS3 and HMBS. IDO, SOCS3, RPLPO, and HMBS primers were designed and checked for specificity by use of BLAST search from the National Center for Biotechnology Information (NCBI). The efficiency of all primers were in the acceptable range for use in the delta delta Ct method. Primer sequences were IDO (122 bp) Forward: CATGCTGCTCAGTTCCTCCA and Reverse: CCAGCATCACCTTTTGAAAGGA; RPLPO (142 bp) Forward: GCAATGTTGCCAGTGTCTG and Reverse: GCCTTGACCTTTTCAGCAA; SOCS3 (66 bp) Forward: GCACAAGCACAAAAATCCAGC and Reverse: AGAAGCCAATCTGCCCCTG and HMBS (70 bp) Forward: TGTGTTGCACGATCCTGAAAC and Reverse: CTCCTTCCAGGTGCCTCAGAA.
4
Monitoring Phosphorylation Dynamics
5
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the Trizol reagent (Invitrogen), and 20 μg of total RNA was used to synthesize first-strand cDNA using 2 μM oligo-dT18 primers with M-MLV reverse transcriptase (Promega, USA) according to the manufacturer’s instructions. Specific primers were designed by PRIMER3plus (software (http://primer3plus.com/cgibin/dev/primer3plus.cgi ); qRT-PCR was performed using SYBR Green fluorophore (Applied Biosystems) on a Bio-Rad CFX Real-Time Thermocycler (Hercules, CA, USA) by Qin et al. [30 (link)]. Three biological experiments were repeated, and the threshold cycles (Ct) of each test target were averaged for triplicate PCR reactions. The relative expression ratio of the TdLTP2 gene was calculated by using the comparative CT method with the actin gene (actin_Fw: 5′-TCCCTCAGCACATTCCAGCAGAT-3′ and actin_Rv: 5′- AACGATTCCTGGACCTG CCTCATC-3′ ) as an internal expression standard [31 (link)]. The relative expression level was calculated from triplicate measurements based on the 2−DDCT equation: DDCT = (CTTstress − CTUBQ10stress) − (CTTcontrol − CTUBQ10control), where CTTstress is the CT of the target gene from stressed samples, CTUBQ10stress is the CT of the UBQ10 gene in stressed samples, CTTcontrol is the CT of the target gene from control samples and CTUBQ10control is the CT of the UBQ10 gene in control samples.
6
RT-qPCR Assay for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total volume of the RT-qPCRs was 12 μL, including 6.25 μL SYBR Green fluorophore (Applied Biosystems ® ), 0.25 μL 10 mM of each primer (forward and reverse), 1 μL cDNA (1:5 dilution previously defined), and 4.25 μL ultrapure water. The reactions were carried out in a Bio-Rad ® CFX Real Time thermocycler, using the following amplification parameters: 95°C for 10 min, 40 95°C cycles for 15 s, 60°C for 1 min with insertion of the melting curve from 65° to 95°C, with a 5°C increase at every fluorescence measure. For each biological repetition, three (triplicate) technical repetitions were carried out, including samples for the control treatment as template-free controls.
7
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total volume of the real-time qPCR was 12.0 mL, containing 6.25 mL SYBR Green fluorophore (Applied Biosystems), 0.25 mL 10 mM of each primer (forward and reverse), 1.0 mL cDNA (1:25 dilution, as previously defined), and 4.25 mL ultra-pure water. The reactions were performed in a Bio-Rad CFX Real-Time Thermocycler (Hercules, CA, USA) using the following amplification parameters: 95°C for 10 min, 40 cycles of 95°C for 15 s, 60°C for 1 min with insertion of the melting curve from 65 to 95°C, and 72°C for 10 min with an increase of 5°C with each measure of fluorescence. Three technical repetitions were performed (triplicate) for each biological repetition.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!