TRIzole reagents were used to extract total RNA from osteoblastic cells. An aliquot of each total RNA (1 μg) sample was pretreated with RNase-free DNase to serve as template for cDNA synthesis. FastStart DNA Master plus SYBR Green I and a LightCycler ST300 (Roche) were used to perform quantitative real-time RT-PCR. The following primer sets were used: Gapdh, forward primer, 5′–CATCTGAGGGCCCACTG–3′ and reverse primer, 5′–GAGGCCATGTAGGCCATGA–3′; C4st1, forward primer, 5′–GCTGGAAGTGATGAGGATGAA–3′ and reverse primer, 5′–GCTGGATGGGATTGTAGAG–3′; C4st2, forward primer, 5′–ATCAGCATCACCAGCAACA–3′ and reverse primer, 5′–TTGGTCATGCTGCCCTG–3′; C6st1, forward primer, 5′–CTGGCATTTGTGGTCATAGTTT–3′ and reverse primer, 5′–AAGAGAGATGCATTCTCCGATAAG–3′; Galnac4s6st, forward primer, 5′–TATGACAACAGCACAGACGG–3′ and reverse primer, 5′–TGCAGATTTATTGGAACTTGCGAA–3′; Csgalnact1, forward primer, 5′–TAAACAGCCCTGTGGAGAG–3′ and reverse primer, 5′–GTCGAAATAGGACAAGTCGC–3′; Csgalnact2, forward primer, 5′–TTAATATCATTGTGCCACTTGCG–3′ and reverse primer, 5′–TAGAATAGACTTGACTTTAGATAGTCCTT–3′; and Akp2, forward primer, 5′–CCTGACTGACCCTTCGC–3′ and reverse primer, 5′–GTCAAGGTGTCTTTCTGGGA–3′. The expression level of each gene was normalized to that of Gapdh.
Lightcycler st300
Manufactured by Roche
Sourced in Germany
The LightCycler ST300 is a real-time PCR instrument designed for quantitative and qualitative nucleic acid analysis. It utilizes optical detection technology to monitor the amplification of DNA or RNA targets in real-time. The LightCycler ST300 is capable of supporting a variety of sample types and assay formats.
Automatically generated - may contain errors
Lab products found in correlation
Faststart dna masterplus sybr green 1, by Roche (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Gotaq hot start polymerase, by Promega (1 mentions)
Trizolr reagent, by Thermo Fisher Scientific (1 mentions)
Moloney murine leukemia virus reverse transcriptase, by Promega (1 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (1 mentions)
Lightcycler software v3, by Roche (1 mentions)
Ex taq dna polymerase, by Takara Bio (1 mentions)
Revertra ace, by Toyobo (1 mentions)
Faststart dna master sybr green 1 kit, by Roche (1 mentions)
Isogen reagent, by Nippon Gene (1 mentions)
5 protocols using lightcycler st300
1
Quantitative RT-PCR Analysis of Chondroitin Sulfate Genes
2
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells using TRIzol reagent (Invitrogen). An aliquot (1 µg) of each total RNA sample was pretreated with RNase-free DNase to serve as a template for cDNA synthesis. Endpoint PCR was performed using GoTaq Hot Start polymerase (Promega). Images of the uncropped gel are shown in a Source Data file. FastStart DNA Master Plus SYBR Green I and a LightCycler ST300 (Roche Diagnostics) were used to perform quantitative real-time reverse transcription-polymerase chain reaction. Primer sequences are listed in Supplementary Table 9 . The expression of each gene was normalized to that of GAPDH (gapdh).
3
Quantitative RT-PCR Analysis of Stem Cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from ES cells using TRIzolR reagent (Invitrogen). cDNA was synthesized from 1 μg of total RNA by using Moloney murine leukemia virus reverse transcriptase (Promega) and a random nonamer primer (TaKaRa Bio Inc., Shiga, Japan). The primer sequences were: Nanog, forward primer 5′-AGAACAAGGTCCTTGCCA-3′ and reverse primer 5′-TGCTTATAGCTCAGGTTCAGAATG-3′; Oct4, forward primer 5′-CATGTTTCTGAAGTGCCCG-3′ and reverse primer 5′-GTAGCCTCATACTCTTCTCGT-3′; Sox2, forward primer 5′-GCCGAGTGGAAACTTTTGTCC-3′ and reverse primer 5′-CGGGAAGCGTGTACTTATCCTT-3′; Nestin, forward primer 5′-CCTGAACACACACTAGAGACA-3′ and reverse primer 5′- TTCAAGCATCTGGTCCTCG-3′; Gata4, forward primer 5′-GCCAACTGTGGCATTACTTTAT-3′ and reverse primer 5′-GACAATGTTAACGGGTTGTGGA-3′; Foxc1, forward primer 5′-CCCCGGACAAGAAGATCACTC-3′ and reverse primer 5′-AGGTTGTGCCGTATGCTGTTC-3′; Brachyury, forward primer 5′-TCCACACACGGCTGTGA-3′ and reverse primer 5′- CCGAGGCTAGACCAGTTA-3′; and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), forward primer 5′-CATCTGAGGGCCCACTG-3′ and reverse primer 5′-GAGGCCATGTAGGCCATGA-3′. Quantitative real-time RT-PCR was performed using FastStart DNA Master plus SYBR Green I in a LightCycler ST300 (Roche). The expression level of each gene was normalized to that of the GAPDH transcript.
4
Quantifying ST6GalNAcVI mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent, according to the manufacturer's protocol (Life Technologies, USA). Concentrations and purities of total RNA were calculated by measuring absorbance at 260 nm with a NanoDrop 1000 (NanoDrop Technologies, Wilmington, DE, USA). ST6GalNAcVI mRNA expression was analyzed using a LightCycler ST300 (Roche, Mannheim, Germany) with LightCycler Software v3.5 (Roche). Primers used for ST6GalNAcVI amplification were 5′-TCAGCAGTGTTCGTGATCCT-3′ (forward) and 5′-GAAGTGGAGCATCACTGACG-3′ (reverse), as described previously (Senda et al. 2007) .
5
Meniscus Cell RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA samples were obtained from superficial zone-excluded meniscal tissues and cultured meniscus cells. Total RNAs were isolated using ISOGEN reagent(Nippon Gene, Toyama, Japan). RNA samples(500 ng) were reverse-transcribed with ReverTra Ace(Toyobo, Osaka, Japan). The cDNAs underwent PCR amplification in the presence of specific primers using exTaq DNA polymerase(TaKaRa, Ohtsu, Japan). For all the RT-PCR fragments, the reaction was allowed to proceed for 32-36 cycles. The following specific primer sets were used: VEGFexon3-4(5'-TGG TGG ACA TCT TCC AGG AG-3' and 5'-TTG GTG AGG TTT GAT CCG CA-3') (13, 14) , HIF-1α(5'-CAC TTC CAC ATA ATG TGA GTT CGC-3' and 5'-GGT TCA CAA ATC AGC ACC AAG CAG G-3') (15) , and glyceraldehyde-3-phosphate dehydrogenase(G3PDH) (16) . Quantitative real-time PCR analyses were performed using a LightCycler ST-300 instrument(Roche Diagnostics, Mannheim, Germany) and FastStart DNA Master SYBR Green I kit(Roche Diagnostics) (17) . The cycle number crossing the signal threshold was selected in the linear part of the amplification curve. Amplification data of G3PDH were used for normalization. These assays were run in triplicate, and relative mRNA levels were normalized with the level of non-stretched inner meniscus cells for every sample.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!