Prime script1 rt reagent kit with gdna erase

Total RNA was extracted from the proximal femur using RNAiso Plus (Total RNA Extraction Reagent, TaKaRa Bio Inc, Tokyo, Japan) in accordance with the manufacturer’s protocol. Total RNA of each group was extracted at optimal effect of induction. Approximately 1000ng of total RNA was reverse transcribed using the Prime Script1TM RT Reagent Kit with gDNA Erase (TaKaRa Bio Inc, Tokyo, Japan). qPCR was performed in triplicate in a 20μl volume, using SYBR1Premix Ex TaqTM II (TaKaRa Bio Inc, Tokyo, Japan) and the CFX96 Touch TM Real-Time PCR Detection System (Bio-Rad, CA, USA) according to the manufacturers’ instructions. Gene expression was determined relative to the housekeeping gene GAPDH using the 2^–ΔΔCt method [39 (link)]. Specific primers were list as follows within the Sangon Biotech (Shanghai, China) designed (Table 1).

Total RNA was extracted from the HT22 cells using RNAiso Plus (Total RNA Extraction Reagent, TaKaRa Bio Inc, Tokyo, Japan) in accordance with the manufacturer’s protocol. Total RNA of each group was extracted at optimal effect of induction. Approximately 1000 ng of total RNA was reverse transcribed using the Prime Script1TM RT Reagent Kit with gDNA Erase (TaKaRa Bio Inc., Tokyo, Japan). qPCR was performed in triplicate in a 20 μL volume, using SYBR1Premix Ex TaqTM14II (TaKaRa Bio Inc., Tokyo, Japan) and the CFX96 Touch TM Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) according to the manufacturers’ instructions. Gene expression was determined relative to the housekeeping gene GAPDH using the 2^−ΔΔCt method. Specific primers were list as follows within (Sangon, Shanghai, China) designed. The primer sequences for 12/15-LOX were: forward 5′CATCTTCTGAGGGGACACTT3′ and reverse 5′ AGGCTCCAGCTTGCTTGAG3′, p38MAPK with forward 5′GAAGATGCTCGTTTTGGACTCAG 3′ and reverse 5′TTCAAAGGACTGGTCATAAGGGT 3′, GAPDH with forward 5′ ACAGCAACAGGGTGGTGGAC3′ and reverse 5′ TTTGAGGGTGCAGCGAACTT 3′.