Mgb nfq

RNA was extracted from 140 µl cell supernatant using the QIAamp viral RNA minikit (Qiagen, Valencia, CA) and eluted in 60 µl of buffer AVE (Qiagen) after on-column DNase treatment with RNase-free DNase (Qiagen). For quantifying ZIKV RNA, quantitative reverse transcriptase PCR (qRT-PCR) was performed on 2 µl of cell supernatant RNA extracted using ZIKV-specific primers (5′ TTGGTCATGATACTGCTGATTGC and 5′ CCYTCCACRAAGTCYCTATTGC) and probe (5′ 6-carboxyfluorescein [FAM]-CGGCATACAGYATCAGGTGCATWGGAG-minor groove binder nonfluorescent quencher [MGB-NFQ]) (Thermo Fisher Scientific, Waltham, MA) and the LightCycler 480 Master hydrolysis probe kit (Roche Applied Science, Indianapolis, IN) using the LightCycler 480 II real-time PCR system (Roche Applied Science). Sequences of the primers and probe targeting ZIKV have been modified from previously published sequences (18 (link)). Quantification of ZIKV RNA copies per milliliter of supernatant was performed against a standard curve of in vitro-transcribed MR766 ZIKV RNA.

DNA was extracted using the NucleoSpin® Tissue Kit (Macherey-Nagel) according to manufacturer’s instructions. Media was diluted 200x before extraction and 100 µL used for extraction. DNA was eluted in 100 µL volume. For assessing the DNA copy number of HSV-1, a 118-nucleotide segment of the gB-1 region was amplified with primers described in^{85 (link)}. The qPCR reaction volume was set to 20 µL and contained 4 µL HOT FIREPol®Probe qPCR Mix Plus (ROX) (Solis Biodyne), primers and probe (forward primer at 0.5 µM, reverse primer at 0.5 µM and probe at 0.3 µM final concentrations), and 1 µl of DNA. Amplification of the target sequence was performed using the StepOne Plus system (Thermo Scientific). The reaction conditions were set to 10 min at 95 °C followed by 45 PCR cycles of two-step amplification (15 s at 95 °C and 60 s at 60 °C). HSV-1 Forward 5’-GCAGTTTACGTACAACCACATACAGC-3’; HSV-1 Reverse 5’-AGCTTGCGGGCCTCGTT-3’; HSV-1 Probe FAM-5’-CGGCCCAACATATCGTTGACATGGC-3’-MGBNFQ (Thermo Fisher Scientific). The efficiency of each round of PCR was determined using 10-fold dilutions of Topo TA plasmids (Invitrogen AB, Stockholm, Sweden) with insert of respective amplicon created according to the manufacturer’s instructions.