Df2434

For Western blotting analysis, protein samples were extracted from the cells through protein extraction reagent (Thermo) and the concentration of protein samples was determined by BCA Quantitative Kit (Beyotime). Then, the difference of protein expression was analysed by Western blotting analysis. The antibodies used in this process were as follows: rabbit anti‐Myocardin (DF2434, Affinity), rabbit anti‐MBNL1 (ab45899, Abcam), mouse anti‐ACTN2 (ab9465, Abcam), rabbit anti‐ANP (ab180649, Abcam), rabbit anti‐TNF‐α (#3707, CST), rabbit anti‐p300 (#86377, CST) and rabbit anti‐GAPDH (#97166, CST). GAPDH expression was used as an internal control.

We performed chromatin immunoprecipitation assay by using a commercial chip assay kit (#56383, CST) according to the manufacturer's instructions. Briefly, each group to be tested was incubated with 1% formaldehyde to cross‐link DNA‐protein complexes. Cells were then collected, washed three times with ice‐cold PBS and lysed in SDS lysis buffer. After centrifugation, the lysates were ultrasonically treated and the DNA was cut into 200‐1000 bp fragments. We then immunoprecipitate the cross‐linked protein at 4°C overnight using an anti‐Myocardin antibody (DF2434, Affinity). IgG acted as the negative control. Finally, DNA from the coprecipitated material was extracted and used as a template for PCR to find the binding site of Myocardin. The primers for PCR analysis are shown below: F: 5′‐CTGCATGAGTCAGTTTTCCA‐3′, R: 5′‐ATT AACT TGTCGGCAGAGAAG‐3′.