Easy spin total rna extraction kit

RNA was isolated from adipocytes or homogenized tissues using an Easy-Spin total RNA extraction kit (iNtRON Biotechnology, Seongnam, Gyeonggi-do, Korea). cDNA was then obtained from 1 μg RNA on a thermal cycler (Bio-Rad) using a Maxime RT PreMix (iNtRON Biotechnology) for 60 min. The cDNA was analyzed by qRT-PCR (Applied Biosystems, Carlsbad, CA, USA) using the TaqMan probe-based gene expression analysis system in combination with TaqMan gene expression master mix containing ROX dye (Applied Biosystems). The primers of the genes used in the experiment were as follows: myoblast determination protein 1 (MyoD, Mm00440387_m1), myogenic factor 4 (MyoG, Mm00446195_g1), myosin heavy chain 1 (MYH1, Mm01332489_m1), myosin heavy chain type (Myf5, Mm00435125_m1), F-box protein (Atrogin1, Mm00499523_m1), muscle RING-finger protein-1 (MuRF1, Mm01188690_m1), transcription factor A (TFAM1, Mm00447585_m1), nuclear respiratory factor 1 (NRF1, Mm01135609_m1), mitochondrial uncoupling protein (UCP3, Mm01163394_m1), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Mm99999915_g1). Expression data were normalized to GAPDH. mRNA levels were calculated as a ratio, using the 2^−ΔΔCT method for comparing between groups of data generated by qRT-PCR.

Total ribonucleic acid (RNA) was extracted from SH-SY5Y cells using the Easy-spin™ Total RNA Extraction kit (iNtRON Biotechnology, Seoul, Korea). The cDNA synthesis was carried out following the instructions of TaKaRa Prime Script TM 1st strand cDNA synthesis kit (TaKaRa Bio, Tokyo, Japan). For qRT-PCR, 1 μL of gene primers with SYBR Green (Bio-Rad Laboratories, Hercules, CA, USA) in 20 μL of reaction volume was applied. The primers were: SIRT1 forward, 5′TGCTCGCCTTGCTGTAGACTTC3′, reverse, 5′GGCTATGAATTTGTGACAGAGAGATGG3′; β-actin (as an internal control): forward, 5′GCAAGCAGGAGTATGACGAG3′, reverse, 5′CAAATAAAGCCATGCCAATC3′. All reactions with iTaq SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA) were performed on the CFX96 real-time PCR detection system (Bio-Rad Laboratories, Hercules, CA, USA).

Red pigment produced by C. metacorallifera was observed in LB media containing either glucose or fructose 3 weeks after the incubation. Mycelia were harvested by scraping fungal mass growing on the membranes with a razor blade, and ground to a fine powder in liquid nitrogen. Total RNA was extracted using an easy-spin total RNA extraction kit (iNtRON Biotechnology, Seoul, Korea). cDNA libraries were constructed, using the TruSeq RNA library preparation kit (San Diego, CA, USA), and sequenced on the HiSeq2000 platform at Macrogen Inc. (Seoul, Korea). Raw reads (paired-end, 100 bp) were further processed and filtered, using the TrimGalore (v0.6.6) (https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/). Filtered reads were mapped to the genome sequence of C. metacorallifera, using the HISAT2 program (v2.1.0). Mapped reads on genomic features, such as exon and intron, were calculated, using the htseq-count program. Gene expression levels in reads per kilobase per million mapped reads (RPKM) values were computed and normalized by effective library size estimated by trimmed mean of M values, using the edgeR R package (v3.26.8).

Well-mixed 0.1 g fresh leaf, stem, and root samples were collected from kalanchoe plants for the gene expression analyses. All samples were immediately frozen in liquid nitrogen. The total RNA was extracted using an Easy-Spin total RNA extraction kit (iNtRON Biotechnology, Seoul, Korea). The total RNA was then used for first-stand cDNA synthesis with the GoScript Reverse Transcription System (Promega, Madison, WI, USA) according to the manufacturer’s protocols. Real-time quantitative PCR was conducted in a real-time PCR system (CFX96, Bio-Rad, Hercules, CA, USA). Reaction volumes (20 μL) contained 1 μL of cDNA, 1 μL of each amplification primer (10 μM), 10 μL of 2 × AMPIGENE qPCR Green Mix Lo-ROX (Enzo Life Sciences Inc., Farmingdale, NY, USA), and 7 μL ddH₂O (double distilled water). The 2^−ΔΔCt method was used for the data analysis.
The expression level of key genes related to phytochromes (KfPHYA and KfPHYB), cryptochromes (KfCRY1), and flowering (KfFT, KfFPF-1, and KfPEF-4) were searched. The primers were designed through https://www.ncbi.nlm.nih.gov/tools/primer-blast/, accessed on 20 August 2021, according to the sequences which were obtained from https://phytozome-next.jgi.doe.gov/info/Kfedtschenkoi_v1_1, accessed on 20 August 2021. Moreover, KfACTIN was selected as a reference gene. All the details of target genes are listed in Table 1.

Total RNA was isolated from TNF-induced Caco-2 cells using the easy-spin Total RNA Extraction Kit (iNtRON Biotechnology, Seoul, Republic of Korea). Next, cDNA was synthesized at 37 °C for 60 min using the Omniscript Reverse Transcription Kit (Qiagen, Hilden, Germany). The cDNA samples were analyzed using the QuantStudio 6 Flex Real-time PCR System (Applied Biosystems, Foster City, CA, USA). Real-time PCR was performed using Gene Expression Master Mix (Applied Biosystems) and mouse-specific TaqMan probes. The genes analyzed in this study were as follows: Glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Hs99999915_g1), tight junction protein 1 (ZO-1; Hs01551871_m1), tight junction protein 2 (ZO-2; Hs00910543_m1), occludin (OCLN; Hs05465837_g1), claudin-1 (CLDN1; Hs0021623_m1), claudin-4 (CLDN4; Hs00976831_s1), myosin light-chain kinase (MLCK; Hs00364926_m1), ELK1 (Elk-1; Hs00901847_m1), nuclear factor kappa B subunit (NFKB1; Hs00765730_m1), mucin 2 (MUC2; Hs03005103_g1), and mucin4 (MUC4; Hs00366414_m1). GAPDH gene was used for normalization of other gene expression data.