The largest database of trusted experimental protocols
Sourced in United States, Italy

The Calu-1 is a laboratory cell line derived from a human lung carcinoma. It is widely used in cancer research and drug development studies.

Automatically generated - may contain errors

119 protocols using calu 1

1

Cell Line Characterization and Maintenance

Check if the same lab product or an alternative is used in the 5 most similar protocols
H1299, A549, Calu-1, H460, HBEC3-KT, and 293T cell lines were purchased from ATCC. H1299, A549, and H460 were cultured in RPMI1640 media, Calu-1 and 283T cells were cultured in DMEM, and HBEC-3KT were maintained in Airway Epithelial Cell Basal Medium (ATCC PCS-300-030). All media were supplemented with 10% FBS, 100 U/mL penicillin, and 100 mg/mL streptomycin except for HBEC-3KT cells, where media were supplemented with Bronchial Epithelial Cell Growth Kit (ATCC PCS-300-040). Cells were expanded initially upon receipt and aliquoted into frozen stocks. All cell lines were validated by STR profiling using PowerPlex 21 (Promega) and routinely tested for Mycoplasma and maintained in culture for <3 months, at which point, a new early-passage vial was thawed.
+ Open protocol
+ Expand
2

Modulation of NOX4 Expression in A549 and Calu-1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
A549 and Calu-1 cell lines, originally purchased from ATCC, were incubated at 37 °C in an atmosphere of 5% CO2 in DMEM supplemented with 10% FBS, penicillin-streptomycin and glutamine (2 mM). Cells were transfected with 100 nM of a control shRNA, two individual shRNA against NOX4 or a pCMV-NOX4 cDNA plasmid with Lipofectamine 2000 (Invitrogen, 11668–019) overnight according to manufacturer's instructions according to our previous study [4] (link). The NOX4 shRNA sequences used in present study were as follows: shRNA1: AGAGTATCACTACCTCCACCAGATGTTGG (sense), and shRNA2: AACCTCTTCTTTGTCTTCTACATGCTGCT (sense). The scramble shRNA sequence is UAGCGACUAAACACAUCAATT (sense).
+ Open protocol
+ Expand
3

NSCLC Cell Culture and ATRA Treatment

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human NSCLC cell lines A549, H1792, and Calu-1 (all three from ATCC) were cultured in Dulbeccos's modified Eagle's medium (DMEM) (Hyclone Laboratories, Inc., South, UT, USA) supplemented with 10% fetal calf serum (FCS) (Invitrogen, Grand Island, NY, USA), 100 U/mL penicillin and 100 U/mL streptomycin (Hyclone Laboratories., Inc.). Cell cultures were performed at 37°C in humidified air with 5% CO2. ATRA (1 μM, Sigma-Aldrich, St. Louis, MO, USA) was applied to the cells for 96 h.
+ Open protocol
+ Expand
4

Lung Cancer Cell Culture Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
A549 (NCI), SK-MES-1 and Calu-1 (both ATCC) were cultured in RMPI-1640, supplemented with 10% FBS, 1%Pen/Strep and 1%l-Glutamine (all from Sigma). NIC-H23 cells were cultured in RMPI-1640, supplemented with 10% FBS, 1%Pen/Strep, 1%l-Glutamine and 1 mM sodium pyruvate (Sigma). LL/2, Ladi 3.1 and Ladi 2.1 cells were cultured in DMEM (Sigma) supplemented with 10% FBS, 1%Pen/Strep and 1%l-Glutamine. Human cells were STR-profiled, used between passages 3 and 15, examined for mycoplasma and maintained in Plasmocin (Invivogen) to prevent contamination.
+ Open protocol
+ Expand
5

Anticancer Effects of MTF and CBX

Check if the same lab product or an alternative is used in the 5 most similar protocols
The murine cancer cell lines CT26 (colon) and 4T1 (breast) and the human cancer cell lines Calu-1 (lung), MDA-MB231 (breast), LNCaP (prostate) and IMR-32 (neuroblastoma) were purchased from ATCC (LGC Standards Srl, Milan, Italy). The human melanoma cell line LB24Dagi (LB24) was kindly provided by Dr. D. Castiglia (Istituto Dermopatico dell’Immacolata, Department of Molecular and Cellular Biology, Rome). All cancer cell lines were cultured at 37 oC under 5% CO2 in DMEM medium (Euroclone, Milan, Italy) supplemented with 1% L-glutamine, penicillin/streptomycin, nonessential amino acids and 10% fetal bovine serum (all from Sigma Aldrich). In all cases experiments were performed in triplicate, glucose concentration of administered medium was set at 11.1 mM. MTF treatments were performed for 24 h at concentrations ranging from 1 mM to 10 mM, while CBX was administered at 180 μM for CT26 and at 135 μM for 4T1 on the basis of preliminary assessment of IC50 dose.
+ Open protocol
+ Expand
6

Cell culture of LUSC and Calu-1 lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human LUSC H520 and Calu-1 cell lines were originally from ATCC (Manassas, VA, USA). Cells were grown in Roswell Park Memorial Institute (RPMI)-1640 media supplemented with 10% FBS (GIBCO, Invitrogen, USA) and in a humidified atmosphere under 5% CO2 and 37 °C temperature in a CO2 incubator (Thermo Fisher Scientific, Waltham, MA, USA).
+ Open protocol
+ Expand
7

Cell Culture Protocols for Cancer Research

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human NSCLC cell lines—A549 and Calu-1, breast cancer cell line—T47D, and cervical carcinoma cell line—HeLa, were purchased from ATCC (Rockville, MD). Normal human bronchial epithelial cells—Beas-2B, were kindly provided by Dr M. Rusin from the Maria Skłodowska-Curie Memorial Cancer Center and Institute of Oncology, Gliwice Branch, Poland. A549, Calu-1 and T47D cells were routinely maintained in RPMI 1640 medium, Beas-2B cell line was cultured in DMEM/F12 medium, and HeLa cell line was maintained in DMEM. Cells were grown at 37 °C in humidified air with 5 % CO2. All culture media were supplemented with 10 % heat-inactivated FBS, 2 mM glutamine and penicillin–streptomycin–amphotericin B solution (10,000 U penicillin, 10 mg streptomycin and 25 μg amphotericin B/ml).
+ Open protocol
+ Expand
8

Culturing Lung Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
A549 (ATCC® CCL-185™), A427 (ATCC® HTB-53™), and Calu-1 (ATCC® HTB-54™) cell lines were obtained from the ATCC (Manassas, VA, USA), INER-51 (CVCL_5531) was a kind gift from the National Institute of Respiratory Diseases (Mexico). The cells were incubated in a humidified atmosphere with 5% CO2 at 37 °C and were maintained in culture medium DMEM/F-12 containing 2.50 mM L-Glutamine, 15 mM HEPES buffer medium (Gibco, Grand Island NY, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Gibco, Grand Island NY, USA) and 100 U/mL penicillin/streptomycin (Gibco, Grand Island NY, USA). The cell lines were grown in plastic tissue-culture dishes (Corning, NY, USA).
+ Open protocol
+ Expand
9

NSCLC Cell Lines Culture Conditions

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human NSCLC cells (A549, H1975, H292, H522, HCC827, Calu-1, H520, H1299, H460, H1993, H2122, and H1703) were purchased from ATCC (Manassas, VA, USA). Other NSCLC cells were kindly provided by Dr. John V. Heymach (MD Anderson Cancer Center, Houston, TX, USA). PC-9R cells (gefitinib-resistant PC-9 cells) were kindly provided by Dr. Mien-Chie Hung (MD Anderson Cancer Center, Houston, TX, USA). PC-9/ER (H) cells (erlotinib-resistant PC-9 cells) were kindly provided by Dr. Jae Cheol Lee (Asan Medical Center, Seoul, Republic of Korea).The cells were maintained in RPMI 1640 medium supplemented with 10 % fetal bovine serum (FBS) and antibiotics. The cells were incubated at 37 °C with 5 % CO2 in a humidified atmosphere.
+ Open protocol
+ Expand
10

Comprehensive Cell Line Database

Check if the same lab product or an alternative is used in the 5 most similar protocols
All cell lines were of human origin. Melanoma cell lines DOR, Beu, and Hbl were previously described [29 (link)]. Other melanoma cell lines (MeWo, SK-MEL-2, SK-MEL-28, SK-MEL-5, SK-MEL-3, Malme 3M, HT144, WM35, WM1552C, and RPMI-7931) were purchased from American Type Culture Collection (ATCC) (Manassas, VA, USA). Normal human melanocytes HeMN-LP were from Cascade Biologics (Portland, OR, USA). NSCLC lung cancer cell lines A549, HT1299, A-427, Calu-1, H-460, H-520, H596, H-661, H-2170, and SK-MES-1, and SCLC cell lines H-446, H-69, H-209, H-82, H-345, H-146, H-378, H-196 were purchased from ATCC. 293FT cells were from Invitrogen (Carlsbad, CA, USA). Colorectal cell lines LoVo, SW480, HCT116 were from ATCC. All other cell lines were purchased also from ATCC: G-401 and A-204 (rhabdoid tumors), U-2 OS and Saos-2 (osteosarcomas), HeLa S3 and C33A (cervical carcinomas), 293 (renal carcinoma), HT-1080 (connective tissue fibrosarcoma), SW-13 (adrenal gland carcinoma), T98G (glioblastoma), IMR90 and WI-38 (normal human fibroblasts), Jurkat (T-cell leukemia), Hep-G2 (hepatocellular carcinoma), SK-N-SH and SH-N-MC (neuroblastomas), PANC-1, PA-TU-8902, MIA PaCa-2, and BxPC-3 (pancreatic carcinomas).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!