For the induction of hypothermia, olanzapine (10 mg/kg) was immediately injected intraperitoneally after the induction of ROSC to reduce the body temperature to 33 °C. At 6 h after the body temperature was dropped, the body temperature was raised to 37 °C as a normal temperature via heating pad. The rectal temperature was measured using a rectal thermometer (Homeothermic Monitoring System; Harvard Apparatus, Holliston, MA, USA). The anesthesia with isoflurane was maintained to prevent hypothermic shock during the experiment. Then, 24 h after CPR was performed, all the rats were sacrificed for further analyses.
Homeothermic monitoring system
Manufactured by Harvard Apparatus
Sourced in United States
The Homeothermic Monitoring System is a lab equipment designed to maintain and monitor the temperature of a subject during experiments. The system provides precise temperature control and continuous monitoring to ensure the subject's physiological conditions remain stable throughout the study.
Automatically generated - may contain errors
Lab products found in correlation
Biosigrz, by Tucker-Davis Technologies (2 mentions)
Ventelite system, by Harvard Apparatus (2 mentions)
Isoflurane, by CP-Pharma (1 mentions)
Meloxicam, by Intas (1 mentions)
Vapro, by Wescor (1 mentions)
Stereotaxic frame, by Stoelting (1 mentions)
Model 683, by Harvard Apparatus (1 mentions)
Rat mouse insulin elisa, by Merck Group (1 mentions)
Actrapid, by Novo Nordisk (1 mentions)
Mouseox plus, by Starr Life Sciences (1 mentions)
Type 340, by Harvard Apparatus (1 mentions)
Mla1213, by ADInstruments (1 mentions)
Powerlab 8 35, by ADInstruments (1 mentions)
Rz6 workstation, by Tucker-Davis Technologies (1 mentions)
Chloral hydrate, by Merck Group (1 mentions)
18 protocols using homeothermic monitoring system
1
Hypothermia Induction Protocol for Post-Cardiac Arrest
2
Auditory Brainstem Response Measurement
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ABRs were recorded at P26 and P42. The measurements were performed in a sound-attenuating chamber (Shanghai Shino Acoustic Equipment Co., Ltd). Animals were anesthetized with intraperitoneal injection of zoletil (50 mg/kg) and xylazine (20 mg/kg), and then kept on a heating pad (Homeothermic Monitoring System, Harvard Apparatus). ABRs were recorded by three subdermal needle electrodes. The active electrode was placed at the vertex of the skull, the reference electrode over the mastoid area of the right ear and the ground electrode on the shoulder of the left side. The free-field sound stimuli were delivered using a speaker (MF1, Tucker-Davis Technologies, Inc, Alachua, FL, USA) placed in front of the vertex of animal about 10 cm. Sound signals were generated by an acoustic stimulation system (Tucker-Davis Technologies), and data were acquired with the software BioSigRZ (Tucker-Davis Technologies). Responses were amplified ×5000 and filtered at 0.03–5 kHz, and thresholds were measured at 5.6, 8, 11.3, 16, 22.6, and 32 kHz. Stimulus intensity was decreased in 5 dB steps until two response waveforms could no longer be identified. Hearing threshold was defined as the lowest sound pressure level that elicited an appropriate ABR response.
3
Isoflurane Anesthesia Protocol for Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mice were placed in a plexiglas box (Induction chamber- 8329001, AgnTho’s AB, Sweden) with approximately 1.8% isoflurane (CP Pharma, Germany) in the breathing air. After loss of responsiveness (LOR), which was verified by gently tilting the box, mice were transferred to a stereotactic frame (prone position) with an initial maintenance concentration of 1.2% isoflurane (flowrate: 192 ml/min) through an anesthesia unit, especially adapted for mice (Univentor 410 Anaesthesia unit, AgnTho’s AB, Sweden). Eye cream (Bepanthen®-Bayer AG, Germany) was applied to the eyes to avoid irritations. An automatic heating pad (Homeothermic Monitoring System, Harvard Apparatus, USA) was placed under the mouse abdomen to maintain a body temperature of 37 °C.
4
Stereotaxic Intracerebroventricular Injection of STZ for AD Induction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to induce AD or prepare sham operation, we stereotaxically injected intracerebroventricular STZ (3mg /kg of b/w; bilateral) or aCSF (5µl/site; bilateral) under sodium thiopentone (50 mg/kg of b/w) anesthesia.
Injection was performed using a 25 µl Hamilton syringe (22G; 700N glass) placed in arm-held Elite-11 mini pump (Harvard Apparatus, USA) at a rate of 1µl/min, while body temperature was maintained during and after surgery in homeothermic monitoring system (Harvard Apparatus, USA) following previous protocol (Ferry et al. 2014).
Briefly, after anesthesia animals were fixed in David-Kopf stereotaxic frame and flat-skull position was achieved cross-checking DV position of Bregma and Lambdoid suture, finally injection was given at AP: -0.84 mm; ML: ±1.5 mm; DV: -3.5 mm coordinates based on rat brain atlas (Paxinos and Charles Watson 2007), through a burrhole made using a drill-bit (>22G) attached to driller (Foredom, USA). After completion of each injection needle was kept in the same position at least for 3min. Further, postoperative care was taken using meloxicam (Intas pharmaceuticals, India); and gentamicin as analgesic and antibiotic respectively for 3-5 days. aCSF was prepared (Mehla et al. 2012a ) and its osmolality checked and maintained at 295±5 mmol/kg to avoid any brain osmotic shock with vapour pressor osmometer (5600; Vapro; Wescor Inc.; USA).
Injection was performed using a 25 µl Hamilton syringe (22G; 700N glass) placed in arm-held Elite-11 mini pump (Harvard Apparatus, USA) at a rate of 1µl/min, while body temperature was maintained during and after surgery in homeothermic monitoring system (Harvard Apparatus, USA) following previous protocol (Ferry et al. 2014).
Briefly, after anesthesia animals were fixed in David-Kopf stereotaxic frame and flat-skull position was achieved cross-checking DV position of Bregma and Lambdoid suture, finally injection was given at AP: -0.84 mm; ML: ±1.5 mm; DV: -3.5 mm coordinates based on rat brain atlas (Paxinos and Charles Watson 2007), through a burrhole made using a drill-bit (>22G) attached to driller (Foredom, USA). After completion of each injection needle was kept in the same position at least for 3min. Further, postoperative care was taken using meloxicam (Intas pharmaceuticals, India); and gentamicin as analgesic and antibiotic respectively for 3-5 days. aCSF was prepared (Mehla et al. 2012a ) and its osmolality checked and maintained at 295±5 mmol/kg to avoid any brain osmotic shock with vapour pressor osmometer (5600; Vapro; Wescor Inc.; USA).
5
Mouse Preparation for Cranial Nerve VIII Exposure
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Details of our mouse preparation were previously published (Schneider et al., 2021 (link)). Briefly, mice were deeply anesthetized with (IP) urethane (1.6 g/kg) and xylazine (20 mg/kg). Heart rate was continuously monitored using a 3-lead EKG and body temperature (∼36.5-37.5°C) was maintained using a homeothermic monitoring system (Harvard Apparatus). A tracheostomy was performed for intubation and mechanical ventilation at a rate of 100 bpm (model 683, Harvard Apparatus). After the head was secured in a stereotaxic frame (Stoelting), a posterior craniotomy and cerebellar aspiration were performed to expose cranial nerve VIII on the right side just before it enters the otic capsule and/or the floor of the 4th ventricle.
6
Auditory Brainstem Response Measurement
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ABR measurements were conducted using a TDT RZ6/BioSigRZ system (Tucker-Davis Tech. Inc., US) in a sound-proof chamber.70 ,71 Animals were anesthetized, and the body temperature was maintained near 37°C using a regulated heating pad with a thermal probe placed under the abdomen (Homeothermic Monitoring System, Harvard Apparatus, US). Sound stimuli, which were generated by SigGen RP (Tucker-Davis Tech. Inc., US), were delivered via a speaker (MF1, Tucker-Davis Tech. Inc., US) placed 10 cm away in front of the animal’s vertex. ABRs were recorded via three subdermal needle electrodes placed at the animal’s vertex (active electrode), left infra-auricular mastoid (reference electrode), and right shoulder region (ground electrode). Signal digitalization and acquisition were done with the software BioSigRZ (Tucker-Davis Tech. Inc., US). The raw signals were amplified (5000x) and bandpass filtered (0.03-5 kHz). The sound level of stimulus started from 90 dB SPL and was decremented in 5 dB steps to ∼10 dB below a threshold, which was defined as the lowest stimulus needed for evoking visible responses. ABR-wave-1 amplitudes were measured and computed offline.
7
Bilateral Carotid Artery Occlusion in Gerbils
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Briefly, as described previously [45 (link)], the gerbils used in this study were anesthetized with a mixture of 2–3% isoflurane in 33% oxygen and 67% nitrous oxide using inhalation anesthesia equipment (Harvard Apparatus, Holliston, MA, USA). The bilateral common carotid arteries were exposed through a 2-cm ventral midline incision in their necks and simultaneously occluded for 5 min with non-traumatic aneurysm clips (Yasargil FE 723K, Aesculap, Tuttlingen, Germany). Five minutes later, the clips were removed to restore cerebral blood flow. The restoration of blood flow was directly observed through the retinal arteries, which are branches of the internal carotid arteries, with an ophthalmoscope (HEINE K180, Heine Optotechnik, Herrsching, Germany). The body temperature of each animal was checked and maintained at a normothermic condition (37 ± 0.5 °C) throughout the whole process of the experiment using a heating pad (homeothermic monitoring system, Harvard Apparatus, Holliston, MA, USA). The gerbils subjected to the sham operation received the same IR surgery without occlusion of both common carotid arteries.
8
Insulin-Stimulated Glucose Clearance in Rats
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Insulin-stimulated glucose clearance (Actrapid; Novo Nordisk, Bagsvaerd, Denmark) was measured by glucometer (Contour, Bayer Healthcare, Basel, Switzerland), in venous blood drawn from the tail vein of overnight-fasted rats with free access to water, 5-30 min following an intravenous insulin bolus, according to Eskens et al. (2013) (link), and using an insulin dose, 1 U kg−1, previously used to reliably assess whole-body response to insulin (Diaz-Castroverde S, 2016 (link); Lambert et al., 2016 (link); Moak et al., 2014 (link)). Rats were anaesthetised throughout in order to reduce stress associated with hypoglycaemia and this has not been found to affect the interpretation of insulin sensitivity in the same rat strains (Hulman et al., 1991 (link), 1993 (link)). Body temperature was controlled using the Homeothermic Monitoring System (Harvard Apparatus). Plasma insulin was determined by ELISA (Rat/Mouse Insulin ELISA, Millipore). Glucose clearance (KITT, % min−1) was calculated from the log(glucose) disappearance curve 5-30 min (Fig. 2 A) as 0.693/t1/2×100 (Lundbaek, 1962 (link)).
9
Anesthesia Induction and Maintenance in Rats
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rats were initially induced in an enclosed chamber with gaseous isoflurane at a concentration of 4.0% mixed in 100% oxygen. Following a loss of righting reflexes, rats were maintained on isoflurane (2.0 to 2.5%) via a nose cone and implanted with a jugular catheter on the right side. Isoflurane was then discontinued and general anesthesia was achieved by slow intravenous administration of urethane (0.67g/ml; final dose 1.35g/kg). Body temperature was maintained at 37⁰C using a Homeothermic Monitoring System connected to a heating pad and rectal probe (Homeothermic Monitoring System, Harvard Apparatus, Holliston, MA) for the remainder of the surgical and recording procedures. Anesthetic plane was assessed throughout the experiment by monitoring for a reflexive withdrawal to a hind paw pinch.
10
Generation and Characterization of SIRS Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Straight knockout mice were generated using CRISPR-Cas9 technology as described before64 (link). The two sgRNA sequences were CGGAGACCCUCAAUCCGCGG and AGAGGUUGACCAGCUAGCAA. The following primers were used for genotyping: PCR-F, CAAAGCTATCGGCTAGCCTACGAC, and PCR-R, ACATGTTCACGCGGCCTTTACTTT; RT-PCR-F, CCGCGGTTCCCGCAGGACGAAACC, and RT-PCR-R, AGAACACTGCCAGAGCTTGCCGTG. F1 mice were backcrossed to C57BL/6 background. For SIRS model, 8–14 weeks old mice were injected through tail vein with mouse TNF (0.3 µg TNF/g body weight). The temperature was monitored for 24 h with a homeothermic monitoring system (Harvard Apparatus) and survival was monitored for 48 h. Blood samples were collected 4 h after injection by retro-orbital method and cytokine levels were determined by ELISA according to the manufacturer’s protocols. Tissues were harvested 8 h after injection and standard H&E staining was performed by the UT Southwestern Histo Pathology Core.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!