Green fluorescent protein

Sources of primary antibodies were IMP1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from Cell Signaling (Danvers, USA); CNOT1 and Ago2 from Santa Cruz Biotechnology (Dallas, USA); green fluorescent protein (GFP) and Flag from Sigma Aldrich (USA). Secondary antibodies conjugated with horseradish peroxidase (HRP) were purchased from Santa Cruz Biotechnology. UCA1 short interfering RNAs (siRNAs), IMP1-siRNA and control siRNA were purchased from Thermo Fisher Scientific (USA). Polymerase chain reaction (PCR) primers used in the study were ordered from Tiangen Biotech Co. (Beijing, China) and are listed in Additional file 1: Table S1.

To deplete Ligase IV, we obtained five shRNAs from Sigma (TRCN0000071158, TRCN0000071159, TRCN0000071160 TRCN0000071161 and TRCN0000071162). As detailed in the manuscript, TRCN0000071159 and TRCN0000071162 were found to induce the most efficient “knock down” and were used for experiments. As a control, we used an shRNA to the Green Fluorescent Protein (GFP; Sigma). To deplete PARP1, we cloned a previously described shRNA (targeting the sequence GGCCCTTGGAAACATGTATG; [18] (link)) into pLKO.1 using standard procedures. Briefly, the forward oligonucleotide (5′ ccggGGCCCTTGGAAACATGTATGctcgagCATACATGTTTCCAAGGGCCtttttg—3′) and the reverse oligonucleotide (5 aattcaaaaaGGCCCTTGGAAACATGTATGctcgagCATACATGTTTCCAAGGGCC‘3′) were co-denatured, reannealed and cloned into AgeI/EcoRI-digested pLKO.1 vector. Clones containing restriction fragments of the appropriate sizes were verified by sequencing with the pLKO.1 primer 5′ CAAGGCTGTAGAGATAATTGGA 3′. For lentiviral infection of MEFs, shRNAs-expressing vectors and packaging plasmids were co-transfected into HEK293T cells using Fugene 6 Transfection Reagent (Promega). MEFs were incubated with filtered supernatants overnight for two cycles and selected in puromycin (2 µg/mL) for three days prior to analysis.