T4 dna ligase

The experiment was carried out in the plant cell culture room of the Inner Mongolia University of Science and Technology (China). The tested licorice variety was Glycyrrhiza uralensis Fisch, and the seeds were purchased from Erdos City, Inner Mongolia, China. A licorice cell suspension culture system was established, and the entire operation was carried out at 25±1°C, with the pH maintained at 5.8 [5 (link)]. Nicotiana benthamiana was grown in a glasshouse and used for subcellular localization analysis.
Some kits, antibiotics, pUCm-T vectors, and primers used in the experiment were purchased from Sangon Biotech (Shanghai, China). Restriction enzymes were purchased from Takara Biomedical Technology (Beijing, China). T4 DNA Ligase, ampicillin, 6-benzyladenine (6-BA), naphthaleneacetic acid (NAA), 2,4-dichlorophenoxyacetic acid (2,4-D), and MeJA were purchased from Sigma-Aldrich (USA). Escherichia coli DH5α, Escherichia coli Top10, Agrobacterium tumefaciens GV3101, and pJG054 plasmid vectors were all available and stored in the laboratory.

General DNA manipulations were performed essentially as previously described (Sambrook et al., 1989 ). DNA restriction endonucleases, T4 DNA ligase, E. coli DNA polymerase (Klenow fragment), and alkaline phosphatase were used as recommended by Sigma–Aldrich (St. Louis, MO, USA). Double-stranded DNA sequencing was performed using the dideoxy-chain termination method (Sanger et al., 1977 (link)) from PCR-amplified DNA fragments with the ABI Prism dye terminator cycle sequencing kit (PerkinElmer, Barcelona, Spain). Oligonucleotides used for genomic DNA amplifications and DNA sequencing were purchased from Sigma–Aldrich (St. Louis, MO, USA). Deduced amino acid sequences were compared with those of DNA translated in all six frames from non-redundant GenBank and EMBL databases, using the BLAST (Altschul et al., 1997 (link)) network service at the National Center for Biotechnology Information and the European Biotechnology Information.

TcOYE coding sequence was PCR-amplified from genomic DNA of T. cruzi Dm28c epimastigotes with Pfu DNA polymerase (Fermentas) usings EcoRI_Fw_OYE: (5′-AAGAATTCATGGCGACGTTCCCTGAACTTCTG-3′), HindIII_Rv_cSTOP_OYE: (5′-AAAAAGCTTTTAGTTGTTGTACGTCGGGTAATCGT-3′), and KpnI_FwOYE (5′-AAGGTACCATGGCGACGTTCCCTGAACTTC-3′) primers. PCR products were cloned in pGEM^®-T Easy plasmid (Promega, USA) using T4 DNA Ligase (Sigma) and sequenced. EcoRI_Fw_OYE and HindIII_Rv_cSTOP_OYE primers were used to subclone into pTREX-n vector (47 (link)), and KpnI_FwOYE and HindIII_Rv_cSTOP_OYE for pQE30 vector (Qiagen).

TcAKR coding sequence was PCR-amplified from genomic DNA of T. cruzi Dm28c epimastigotes with Pfu DNA polymerase (Fermentas, Vilnius, Lithuania) using Fw_TcAKR_XbaI_Dm28c (AATCTAGAATGAAATGCAATTACAGCTGTGTG) and Rv_TcAKR_HindIII_cSTOP_Dm28c (AAAAGCTTTCACTCCTCTCCACCAGAGAAAAAATTATC) primers. PCR products were cloned in pGEM^®-T Easy plasmid (Promega, WI, USA) using T4 DNA Ligase (Sigma-Aldrich, WI, USA) and sequenced. The coding sequence was subcloned into the pTREX-n vector [24 (link)] and the pQE30 vector (Qiagen, Venlo, The Neterlands). Recombinant TcAKR purification under non-native conditions was performed with nickel-charged affinity resin (Ni-NTA). The recombinant protein purity was analyzed by 12% SDS-PAGE stained with colloidal coomassie (Brilliant Blue G-250, Sigma-Aldrich, WI, USA), and protein concentration was determined by the Bradford method [25 (link)]. A polyclonal antiserum against TcAKR was obtained from New Zealand White rabbits after intraperitoneal injection of 100 μg of recombinant TcAKR in Freund’s Complete Adjuvant (Sigma-Aldrich, WI, USA), followed by two immunizations with 50 μg of recombinant protein in Freund’s Incomplete Adjuvant (Sigma-Aldrich, WI, USA). Serum was obtained after 15 days of the last boost.

BALB/c mice were purchased from the Experimental Animal Center in Zhejiang province; mice myeloma cell S/P2.0 were available from our laboratory; Freund's complete adjuvant (FA) and Freund's incomplete adjuvant (FIA) were purchased from Sigma Company; T4 DNA ligase, TMB Chromogen Solution, and Bradford Protein Assay Kit were purchased from Beyotime Biotech; Polyethylene glycol 1500 (PEG 1500) and affinity chromatography (Ni‐NTA Agarose) were purchased from Shanghai Sangon Biotech; the recombinant N protein (Baculovirus‐Insect Cells) and the recombinant N protein of SARS‐CoV‐2 Delta (B.1.617.2) variant were purchased from Sino Biological Inc.
Chlorauric acid is purchased from Shanghai National Pharmaceutical Company; nitrocellulose film (HCN4878711), glass cellulose film (20100701), Polyvinyl chloride (PVC) board (SM31‐25), filter paper (B3MN44840), and packaging shell are all purchased from Shanghai Jinbiao Biotechnology Co., Ltd.; microcomputer automatic cutting machine and XYZ three‐dimensional film‐gold spraying instrument were all purchased from Biodot Company.