Human cervical cancer cell line RL95-2 was provided by the Department of Pathophysiology, Anhui Medical University. RT-PCR reverse transcription kit and miRNA isolation kit were purchased from Qiagen, Inc. (Valencia, CA, USA). Fetal bovine serum (FBS) was purchased from Gibco (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Tetramethyl azoline blue (MTT) and dimethylsulfoxide (DMSO) were purchased from Sigma-Aldrich (Sigma-Aldrich; Merck KGaA, St. Louis, MO, USA). Lipofectamine™ 2000 transfection reagent was purchased from Invitrogen; Thermo Fisher Scientific, Inc. Annexin V-FITC/PI apoptosis kit was purchased from BestBio (Shanghai, China). The study was approved by the Ethics Committee of Chongming Branch Hospital, Affiliated Xinhua Hospital, School of Medicine, Shanghai Jiaotong University (Suizhou, China). Signed informed consents were obtained from the patients or the guardians.
Annexin 5 fitc pi apoptosis kit
Manufactured by BestBio
Sourced in China
The Annexin V-FITC/PI apoptosis kit is a laboratory tool used to detect and analyze apoptosis, a type of programmed cell death. It contains Annexin V-FITC, a fluorescent protein that binds to phosphatidylserine, and propidium iodide (PI), a DNA-binding dye. This kit enables the identification of cells undergoing early and late stages of apoptosis.
Automatically generated - may contain errors
Lab products found in correlation
Dimethyl sulfoxide (dmso), by Merck Group (2 mentions)
Rt pcr reverse transcription kit, by Qiagen (1 mentions)
Mirna isolation kit, by Qiagen (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Cell counting kit 8 cck 8, by Sangon (1 mentions)
Recombinant lentivirus, by Hanbio Biotechnology (1 mentions)
Sh nc, by Hanbio Biotechnology (1 mentions)
Antibodies against nf κb, by Cell Signaling Technology (1 mentions)
Cleaved caspase 3, by ABclonal (1 mentions)
P stat3, by Cell Signaling Technology (1 mentions)
Ecl western blotting detection reagent, by Beyotime (1 mentions)
P nf κb, by Cell Signaling Technology (1 mentions)
Facsaria 3, by BD (1 mentions)
Modfit lt v3, by BD (1 mentions)
Mouse monoclonal anti bcl 2, by Santa Cruz Biotechnology (1 mentions)
Reactive oxygen species assay kit, by Beyotime (1 mentions)
Cck 8, by BestBio (1 mentions)
Cell cycle kit, by BestBio (1 mentions)
Beckman fc500, by Beckman Coulter (1 mentions)
13 protocols using annexin 5 fitc pi apoptosis kit
1
Apoptosis Induction in RL95-2 Cervical Cancer Cells
2
Quantifying dHL-60 Cell Apoptosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The rates of dHL-60 cell apoptosis were detected via flow cytometry (FCM) analysis using an Annexin V-FITC/PI Apoptosis kit (Bestbio, Nanjin, China). dHL-60 cells were seeded in a 6-well plate with 100 nM PMA for 24 h, then re-suspended in 400 μL binding buffer and stained with 10 μL of PI (propidium iodide) and 5 μL of FITC Annexin V. The treatments were continued for 16 min at 4 °C in the dark conditions. After that, the samples were submitted to a flow cytometer (Agilent, BD FACSCalibur, Santa Clara, CA, USA). Annexin V-positive and PI-negative dHL-60 cells were determined as the early apoptotic cells; furthermore, Annexin V- and PI-positive cells were identified as the late apoptotic cells.
The results were analyzed by FlowJo 1.6.0 software (Ashland, OR, USA).
The results were analyzed by FlowJo 1.6.0 software (Ashland, OR, USA).
3
Lentiviral shRNA Knockdown of HK2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
shRNA targeting HK2 (shHK2) and a negative control shRNA (shNC) were synthesized by Hanbio Biotechnology (Shanghai, China). The sequence of HK2 shRNA (GATCCGCCACAACTGTGAGATTGGTCTCATTTTCAAGAGAAATGAGACCAATCTCACAGTTGTGGTTTTTTC) was inserted into BamHI and EcoRI sites of pHBLV-U6-Scramble-ZsGreen-Puro. Recombinant lentivirus was constructed by Hanbio Biotechnology (Shanghai, China). Mouse anti-human HK2 antibody was purchased from Abcam (UK). Cell counting kit-8 (cck-8) was purchased from Sangon Biotech (Shanghai, China). Annexin V-FITC/PI Apoptosis kit was purchased from Bestbio (Shanghai, China).
4
Apoptosis Assessment by Annexin V-FITC/PI
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A commercial Annexin V-FITC/PI Apoptosis Kit (BB-4101, BestBio, Shanghai, China) was used to evaluate the early and late apoptosis rates according to the manufacturer's instructions. In brief, 0.5 mL of cultured cells (1 × 106 cells/mL) was first stained with 5 μL of Annexin V-FITC in the dark for 15 min and then stained with 5 μL of PI for 5 min. The apoptosis rate was immediately analyzed using flow cytometry.
5
Apoptosis Analysis by Flow Cytometry
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The analysis of apoptosis was performed according to the manufacturer’s instructions for the Annexin V-FITC/PI apoptosis kit (BestBio China). A549 cells were seeded in 6-well plates (BestBio China) with 3×105 cells per well and treated with 10 μM TVN or 1‰ DMSO for 60 h. Then, the cells were harvested and washed twice with cold PBS and resuspended in 400 µL of binding buffer containing 5 µL of Annexin V-FITC and 10 μL of PI working solution at 4°C for 15 min in the dark. Apoptosis was analyzed by flow cytometry (BD Biosciences company, United States of America) for at least 10,000 events.
6
Flow Cytometric Analysis of LX-2 Cell Apoptosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The apoptosis of LX‐2 cells was analysed by flow cytometry using the Annexin V‐FITC/PI Apoptosis Kit (Best Bio, China). Cells were centrifuged and suspended in 400 µL Annexin binding solution. Then, 5 µL Annexin V‐FITC staining solution was added to the suspension and incubated for 15 minutes followed by the addition of PI and incubated for 5 minutes in the dark at 4°C before flow cytometry analysis (Beckman Coulter, USA).
7
Biochemical Assays for Cell Apoptosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RUT (purity, 98%) was purchased from Aladdin, China. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was obtained from Solarbio, China. Annexin V-FITC/PI apoptosis kit was purchased from Bestbio, China. Dimethyl sulfoxide (DMSO) was provided by Sigma-Aldrich. Antibodies against NF-κB, p-NF-κB, STAT3, and p-STAT3 were purchased from Cell Signaling Technology. Other antibodies used in this study were: Bcl-2 (Affinnity biosciences), cleaved-Caspase3 (Abclonal), CDK4 (Proteintech) and GAPDH (Santa). The secondary antibody used in this study was HRP conjugated goat anti-mouse/rabbit (Abclonal). The electrochemiluminescence (ECL) Western blotting detection reagents were obtained from Beyotime.
8
Assessing Gefitinib and AZD-9291 Effects
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were incubated with Gefitinib (10 μM) and AZD-9291 (0.1 μM) for 48 h. Suspended and adherent cells were both collected. Cell apoptosis was detected by Annexin VFITC/PI Apoptosis Kit (BestBio Ltd., China) according to the manufacturer's instructions and analyzed by flow cytometry (FACS Aria III, BD, USA).
To detect cell membrane expression of PD-L1, cells were digested and incubated in 100 μL PBS containing 2% goat serum at room temperature for 20 min. After washed with PBS for 3 times, cells were incubated with the anti-PD-L1 antibody (listed in SupplementalTable S1 ) in the dark at 4°C for 30 min. After washing with PBS, the stained cells were resuspended in 400 μL PBS. The samples were then analyzed by flow cytometry (FACS Aria III, BD, USA).
To detect cell membrane expression of PD-L1, cells were digested and incubated in 100 μL PBS containing 2% goat serum at room temperature for 20 min. After washed with PBS for 3 times, cells were incubated with the anti-PD-L1 antibody (listed in Supplemental
9
Apoptosis Analysis by Flow Cytometry
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Flow cytometry analysis was determined using the annexin V/PI method (annexin V-FITC/PI apoptosis kit; BestBio) in accordance with the manufacturer's protocols. The cells were seeded into 25-ml flasks and divided into groups according to treatment. After 48 h, the cells were washed, harvested, resuspended in 100 µl 1X binding buffer and stained with 5 µl FITC-annexin V and 5 µl PI for 15 min at room temperature in the dark. The samples were analyzed via flow cytometry (Excitation=488 nm; Emission=530 nm). The percentage distributions of normal, early apoptotic, late apoptotic and necrotic cells were calculated using ModFitLT v3.0 software (BD Biosciences) and the results were calculated from three independent experiments.
10
Annexin V-FITC/PI Apoptosis Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An Annexin V-FITC/PI apoptosis kit (BestBio, Shanghai, China) was used to detect
cell apoptosis. Transfected cells (1 × 105 cells/well) were seeded
into a 6-well plate for 24 h, collected, and analyzed by flow cytometry 72 h
after irradiation. The experiment was repeated thrice.
cell apoptosis. Transfected cells (1 × 105 cells/well) were seeded
into a 6-well plate for 24 h, collected, and analyzed by flow cytometry 72 h
after irradiation. The experiment was repeated thrice.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!