The shRNA oligonucleotides contained sense strands of equine Mkx nucleotide sequences, followed by short spacers (TTCAAGAGA), the reverse complement of the sense strands, and six thymidines as RNA polymerase III transcriptional stop signal. The detailed oligonucleotide sequences, targeting the open reading frame (shMKX) and 3′-untranslated region (shM3U) of equine Mkx gene, are shown in Supplemental table 2 . The oligonucleotides were annealed and ligated into the HpaI and XhoI sites of pLB vector (Addgene plasmid#11619). All the plasmids were confirmed by sequence analysis. Replication-defective lentiviruses were produced in 293 T packaging cells, and supernatant containing viral particles were harvested at 48, 60, and 72 h and filtered through a 0.45 μm PVDF filter (Millipore, Ireland). Cells were exposed to viral supernatant at 1:1 ratio for six hours in the presence of Polybrene B (8 μg/mL). The infection efficiency was evaluated by the percentage of green fluorescent protein (GFP)-positive cells under a fluorescent microscope.
Plb vector
Manufactured by Addgene
The PLB vector is a plasmid DNA construct commonly used for gene expression in bacterial systems. It contains key elements necessary for replication and selection in E. coli hosts. The vector backbone provides a platform for inserting genes of interest, enabling their expression and study in a controlled laboratory environment.
Automatically generated - may contain errors
4 protocols using plb vector
1
shRNA-Mediated Knockdown of Equine Mkx
2
Generating Lentiviral Vectors with Minimal Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate the lentivirus vector (pLS-mP), a minimal promoter sequence, which originates from pGL4.23 (Promega), including an SbfI site was obtained by annealing of oligonucleotides (Sense: 5′-CTAGACCTGCAGG CACTAGAGGGTATATAATGGAAGCTCGACTTCCAGCTTGGCAATCCGGTACTGTA-3′; Antisense: 5′-CCGGTACAGTACCGGATTGCCAAGCTGGAAGTCGAGCTTCCATTATATACCCTCTAGTGCCTGCAGG T-3′; SbfI site is underlined) and subcloned into XbaI and AgeI sites in the pLB vector (Addgene 11619) (Kissler et al. 2006 (link)), replacing the U6 promoter and CMV enhancer/promoter sequence in the vector. To generate pLS-mP-SV40, the SV40 enhancer sequence was amplified from pGL4.13 (Promega) using primers (Forward: 5′-CAGGGCCCGCTCTAGAGCGCAGCACCATGGCCTGAA-3′; Reverse: 5′-TGCCTGCAGGTCTAGACAGCCATGGGGCGGAGAATG-3′) and inserted into XbaI site in the vector using In-Fusion (Clontech). pos1, pos2, neg1, and neg2 sequences were amplified from human (pos1, neg2, pos2) or mouse (neg1) genome and inserted into EcoRV and HindIII site in pGL4.23 (Promega). Primers used are shown in Supplemental Table S3 , and the annotated plasmid sequence file is available as Supplemental File 1 .
3
shRNA-Mediated Knockdown of Equine Mkx
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The shRNA oligonucleotides contained sense strands of equine Mkx nucleotide sequences, followed by short spacers (TTCAAGAGA), the reverse complement of the sense strands, and six thymidines as RNA polymerase III transcriptional stop signal. The detailed oligonucleotide sequences, targeting the open reading frame (shMKX) and 3′-untranslated region (shM3U) of equine Mkx gene, are shown in Supplemental table 2 . The oligonucleotides were annealed and ligated into the HpaI and XhoI sites of pLB vector (Addgene plasmid#11619). All the plasmids were confirmed by sequence analysis. Replication-defective lentiviruses were produced in 293 T packaging cells, and supernatant containing viral particles were harvested at 48, 60, and 72 h and filtered through a 0.45 μm PVDF filter (Millipore, Ireland). Cells were exposed to viral supernatant at 1:1 ratio for six hours in the presence of Polybrene B (8 μg/mL). The infection efficiency was evaluated by the percentage of green fluorescent protein (GFP)-positive cells under a fluorescent microscope.
4
Lentiviral Expression of FMNL3-V5 and DsRed
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Biodesign Institute DNASU Plasmid Repository. FMNL3-V5 was expressed in U937 FMNL3 KO using lentiviruses generated in 293E cells co-transfected with the packaging constructs psPAX2 (Addgene plasmid 12260) and pCMV-VSV-G (Addgene plasmid 8454).
U937 cell lines stably expressing red fluorescent protein membrane were generated using pDsRed-Monomer-Mem (Takara Bio) cloned into pLB vector from Addgene (Addgene plasmid 11619) as previously described (96) (link). The corresponding lentiviruses were generated in 293E cells co-transfected with the packaging constructs psPAX2 and pCMV-VSV-G as described.
U937 cell lines stably expressing red fluorescent protein membrane were generated using pDsRed-Monomer-Mem (Takara Bio) cloned into pLB vector from Addgene (Addgene plasmid 11619) as previously described (96) (link). The corresponding lentiviruses were generated in 293E cells co-transfected with the packaging constructs psPAX2 and pCMV-VSV-G as described.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!