Phusion u green hot start dna polymerase

The standard Ung was obtained from Thermo Fisher Scientific, whereas hlUng was from Roche. The polymerase used was the Phusion U Green Hot Start DNA Polymerase (Thermo scientific). We used 0.5 U of the Ung and 2 U of the Taq Polymerase in our reactions. The primers used to amplify the repeat tract from the GFP locus were oVIN-460 and oVIN-1425. The PCR program was as follow: 50 °C for 2 min and 5 min at 95 °C for the standard Ung, or 20 °C for 10 min followed by 7 minutes at 95 °C for hlUng. Then there were 35 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min 30 s. Ung was neutralized by the addition of Proteinase K (Promega) immediately after the PCR run to a final concentration of 100 μg ml⁻¹ and incubated at 37 °C for 1 h. Sanger sequencing was done by Microsynth AG (Balgach, Switzerland).

Genomic DNA was obtained from young leaves in all cases using a high-throughput method described by Mau et al. (2021 (link)). PCR was performed using the specific primers for eGFP (eGFP-F: ATGGTGAGCAAGGGCGAGGAG and Seq-eGFP-R: CGCCGGACACGCTGAACTTGTG; refer to Supplementary Table 1) and the Phusion U Green Hot Start DNA Polymerase (Thermo Fisher Scientific, Cat# F562L, Waltham, MA, USA) in a volume of 10 μL using 2 μl sample of DNA and 2.5 μM of each primer. The amplifications were run on a Mastercycler EP Gradient S (Eppendorf, Hamburg, Germany) under the following conditions: 3 min initial denaturation at 98°C; 40 cycles of amplification with 10 s at 98°C, 30 s at 54°C, and 1 min at 72°C; and 10 min of final elongation at 72°C. PCR success was verified with 1.5% agarose gel electrophoresis.