Chromo4 system

Manufactured by Bio-Rad

Sourced in United States, Italy, France

The Chromo4 system is a real-time PCR detection system designed for quantitative analysis of DNA and RNA samples. It features four independent optical channels for simultaneous detection of multiple targets, and is compatible with a wide range of fluorescent dyes and probes.

Automatically generated - may contain errors

Lab products found in correlation

Maxima sybr green rox qpcr master mix, by Thermo Fisher Scientific (5 mentions) Rneasy mini kit, by Qiagen (3 mentions) Iscript cdna synthesis kit, by Bio-Rad (3 mentions) Rt2 sybr green qpcr mastermix, by Qiagen (3 mentions) Iq sybr green supermix, by Bio-Rad (3 mentions) Iqtm sybr green supermix, by Bio-Rad (2 mentions) Exilent sybr green master mix, by Bio-Rad (2 mentions) Trizol reagent, by Merck Group (2 mentions) Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions) Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (2 mentions) Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions) Power sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions) Nucleospin rna plant extraction kit, by Macherey-Nagel (2 mentions) Moloney murine leukemia virus reverse transcriptase, by Promega (2 mentions) Nucleospin soil genomic dna isolation kit, by Macherey-Nagel (2 mentions) Tissuescan colon cancer cdna array, by OriGene (2 mentions) Mircury lnatm universal rt microrna pcr kit, by Qiagen (1 mentions) Sybr green master mix, by Qiagen (1 mentions) Lna pcr primer set, by Qiagen (1 mentions) Sybr green supermix, by Bio-Rad (1 mentions)

Spelling variants of this product

Chromo4 Real-Time PCR Detection System (52 citations) Chromo4 (51 citations) Chromo4 real-time PCR system (34 citations) Chromo4 Detection System (9 citations) Chromo4 real-time detection system (8 citations) DNA Engine Chromo4 system (6 citations) Chromo4™ Real-Time system (4 citations) Chromo4TM System apparatus (3 citations) Chromo4 RT-PCR detection system (2 citations) Chromo4 operating system (2 citations)

45 protocols using chromo4 system

Quantifying Gene Expression Using qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

To quantify gene expression, qRT-PCR reactions were performed using ExiLENT SYBR Green master mix using Chromo4TM system (Bio-Rad, Foster City, California), as per the manufacturer’s instructions. The expression levels were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression as an endogenous control. Thermal cycling was performed using the following cycling conditions: 95°C pre-denaturation for 5 mins followed by 95°C denaturation for 20 s, 60°C annealing for 30 s, and 72°C extension for 30 s. The samples were run in triplicates. The relative expression was measured and reported using the 2^−ΔΔCt method. To confirm the presence of the Smo primers, blasting pre-used primers in bone marrow and UCSC database were exploited and then primers were double-checked with gel electrophoresis. The sequences of the primers are shown in Table 1.Table 1

Primer sequences of Smo and GAPDH

Gene	Primer Sequence (5ʹ to 3ʹ)	Primer length	Amplicon length	Tm	GC%
Smo	F: TTACCTTCAGCTGCCACTTCTAC	23 bp	321 bp	60.31	47.83
	R: CCTTGGCAATCATCTTGCTCTTC	23 bp		60.18	47.83
GAPDH	F: CAAGGCTGAGAACGGGAA	18 bp	90 bp	56.88	55.56
	R: GCATCGCCCCACTTGATTTT	20 bp		59.47	50

Sheybani Z., Rahgozar S, & Ghodousi E.S. (2019). The Hedgehog signal transducer Smoothened and microRNA-326: pathogenesis and regulation of drug resistance in pediatric B-cell acute lymphoblastic leukemia. Cancer Management and Research, 11, 7621-7630.

+ Open protocol

+ Expand

miR-326 and RNU6 Expression Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Complementary DNA (cDNA) synthesis for miR-326 and U6 small nuclear RNA (RNU6) was carried out on 100 ng of total RNA, using the miR-CURY LNA^TM Universal RT microRNA PCR kit (Exiqon, Denmark). The tubes were incubated at 42 °C for 60 min, and then reverse transcriptase enzyme was heat-inactivated at 95 °C for 5 min. Afterward, cDNA product was subjected to real-time quantitative PCR using ExiLENT SYBR Green master mix, along with the specific locked nucleic acid (LNA) PCR primer sets (Exiqon, Denmark) on a Chromo4^TM system (Bio-Rad, USA). RNU6 small nucleolar RNA was quantified as internal control for data normalization. A no-reverse transcription (no-RT) control was used to detect any potential non-specific amplification of genomic DNA and No Template Controls (NTC) were run to evaluate contamination. All reactions were performed in duplicates.

Ghodousi E.S, & Rahgozar S. (2019). Recovery of MicroRNA from Stored Bone Marrow Aspirate Slides. Avicenna Journal of Medical Biotechnology, 11(1), 24-27.

+ Open protocol

+ Expand

Real-Time qPCR Gene Expression Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted by using Trizol Reagent (Sigma-Aldrich, Oakville, ON, Canada, and St. Louis, MO, USA) according to the manufacturer’s instructions. 1 μg of cDNA was synthesized using RevertAid H-Minus M-MuLV Reverse Transcriptase (Fermentas, Hannover, MD, USA) as previously explained [52 (link)]. Real-time quantitative (qPCR) reactions were performed in triplicate in a final volume of 25μL using 1× SybrGreen SuperMix and Chromo4TM System apparatus (Biorad, Monza, Italy) as previously described [19 (link)]. Primer pairs for the genes under analysis (Table S1) were designed ad hoc and synthesized by TibMolBiol custom oligo synthesis service (Genova, Italy). Amplification conditions were as follows: 3 min at 95 °C, followed by 5 s at 95 °C and 1 min at 60 °C or 64 °C for 40 cycles. A melting curve of qPCR products (65–94 °C) was also performed to ensure the absence of artefacts. The relative quantity of target mRNA was calculated by the comparative Cq method using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as housekeeping gene and expressed as fold change with respect to controls [53 (link)].

El Rashed Z., Lupidi G., Kanaan H., Grasselli E., Canesi L., Khalifeh H, & Demori I. (2021). Antioxidant and Antisteatotic Activities of a New Fucoidan Extracted from Ferula hermonis Roots Harvested on Lebanese Mountains. Molecules, 26(4), 1161.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using Trizol reagent, cDNA was synthesized and quantitative real-time PCR (qPCR) performed in quadruplicate using 1× IQ^TMSybrGreen SuperMix and Chromo4^TM System apparatus (Biorad, Milan, Italy). The relative quantity of target mRNA was calculated by the comparative Cq method using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as housekeeping gene, and expressed as fold induction with respect to controls. Primer pairs designed ad hoc starting from the coding sequences of Rattus norvegicus (http://www.ncbi.nlm.nih.gov/Genbank/GenbankSearch.html, accessed on 22 May 2022) and synthesized by TibMolBiol (Genova, Italy) are reported in previous papers [27 (link)].

Baldini F., Khalil M., Bartolozzi A., Vassalli M., Di Ciaula A., Portincasa P, & Vergani L. (2022). Relationship between Liver Stiffness and Steatosis in Obesity Conditions: In Vivo and In Vitro Studies. Biomolecules, 12(5), 733.

+ Open protocol

+ Expand

Rumen Microbiome Analysis via qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Approximately, 1 mL of rumen fluid from in vitro study was extracted for total genomic DNA (gDNA) following to the method of QIAamp Fast DNA Stool Mini kit (Qiagen, Hilden, Germany). The gDNA quality (the concentration at ≥50 ng/μL) was indicated by absorbance at OD260/280 = 1.8 to 2.0 using Nanodrop spectrophotometer (Thermo Scientific, USA). The microbial population including Ruminococcus albus, Ruminococcus flavefaciens, Fibrobactor succinnogenes, Butyribrivio fibrisolvens, Megasphaera elsdenii, and Methanobacteriales were identified using the specific primers through real-time polymerase chain reaction (PCR) technique, as shown in Table 1. The real-time PCR amplification and detection were performed by Maxima SYBR Green qPCR Master Mix using Chromo 4TM system (Bio-Rad, Hercules, CA, USA), more detail of the protocols was demonstrated in Koike and Kobayashi [30 (link)].

Matra M., Phupaboon S., Totakul P., Prommachart R., Shah A.A., Shah A.M, & Wanapat M. (2023). Microencapsulation of Mitragyna leaf extracts to be used as a bioactive compound source to enhance in vitro fermentation characteristics and microbial dynamics. Animal Bioscience, 37(1), 74-83.

+ Open protocol

+ Expand

Quantitative Analysis of miR-16-5p

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ectopic expression of miR-16-5p was confirmed by real-time PCR assay. qRT-PCR for miR-16-5p converted to cDNA was carried out using the miRCURY LNA SYBR Green PCR kit (Qiagen, Germany), with 50 ng/μL of the cDNA samples per 10 μL final reaction volume, on a Chromo4TM system (BioRad, Foster City, California) as described by the manufacturer. Primers for miR-16-5p quantitative RT-PCR were obtained from Qiagen, and RNU6 small nuclear RNA ((Exiqon, Denmark) was employed as endogenous control for data normalization. ΔΔCt Method was applied to perform data analysis.

Zanjirband M., Rahgozar S, & Aberuyi N. (2023). miR-16-5p enhances sensitivity to RG7388 through targeting PPM1D expression (WIP1) in Childhood Acute Lymphoblastic Leukemia. Cancer Drug Resistance, 6(2), 242-256.

+ Open protocol

+ Expand

Quantitative Assay for Cellulolytic Bacteria and Methanogens

Check if the same lab product or an alternative is used in the 5 most similar protocols

The targeted bacteria were cellulolytic bacteria (F. succinogenes, R. albus, and R. flavefaciens) and methanogens. To establish a quantitative assay, we amplified target 16s rDNA of each species by using specific primers and PCR conditions as described previously, the purified DNA was quantified by spectrophotometry by comparing the products with serial 10- fold dilutions from 101 to 108 DNA copies of the previously quantified DNA standards. Real-time PCR amplification and detection were performed in a Chromo 4TM system (Bio-Rad, USA). In brief, Biostools QuantiMix Easy SYG Kit was used for PCR amplification. Samples were assayed in duplicate in a 20 μL reaction mixture contained 4 to 6 mM MgCl₂, 10 μL of Mastermix (including; Taq DNA polymerase, reaction buffer, dNTP mixture, MgCl₂ and SybrGreen), 2 μL of DNA template, and 0.8 μL of each primer (10 μM/μL).

Polyorach S., Wanapat M, & Cherdthong A. (2014). Influence of Yeast Fermented Cassava Chip Protein (YEFECAP) and Roughage to Concentrate Ratio on Ruminal Fermentation and Microorganisms Using In vitro Gas Production Technique. Asian-Australasian Journal of Animal Sciences, 27(1), 36-45.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using Trizol reagent, cDNA was synthesized and quantitative real-time PCR (qPCR) was performed in quadruplicate using 1x IQTMSybrGreen SuperMix and Chromo4TM System apparatus (Biorad, Milan, Italy) [37] (link). The relative quantity of target mRNA was calculated by the comparative Cq method using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as housekeeping gene, and expressed as fold induction with respect to controls [51] . Primer pair sequence have been previously reported [37] (link) [38] [52] [53] .

Vergani L., Vecchione G., Baldini F., Grasselli E., Voci A., Portincasa P., Ferrari P.F., Aliakbarian B., Casazza A.A, & Perego P. (2018). Polyphenolic extract attenuates fatty acid-induced steatosis and oxidative stress in hepatic and endothelial cells. European journal of nutrition, 57(5).

+ Open protocol

+ Expand

Quantitative Reverse Transcription PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

For quantitative Reverse Transcription PCR, RNA samples were reverse-transcribed into complementary DNA (cDNA) using SuperscriptII reverse transcriptase (Invitrogen). The cDNA was used to quantify gene expression using a SYBR Green quantitative PCR kit (Sigma) and gene-specific primers (see Additional file 2). Themocycling and intensity detection was carried out with Chromo4 system on MJ Research Thermal cycler and data extracted using Opticon Monitor software.

Rallapalli G., Kemen E.M., Robert-Seilaniantz A., Segonzac C., Etherington G.J., Sohn K.H., MacLean D, & Jones J.D. (2014). EXPRSS: an Illumina based high-throughput expression-profiling method to reveal transcriptional dynamics. BMC Genomics, 15(1), 341.

+ Open protocol

+ Expand

Cervical Tissue DNA Extraction and Screening

Check if the same lab product or an alternative is used in the 5 most similar protocols

De-identified formalin-fixed paraffin-embedded (FFPE) samples of cervical tissues from study participants were retrieved from the Section of Surgical Pathology at the Department of Laboratories of the Philippine General Hospital. 5 μm slices of the FFPE samples were used for total genomic DNA extraction according to the protocol of Maxwell® RSC DNA FFPE Kit. Extracted DNA in an aqueous solution was quantified (ratios 260/280 and 260/230) using NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA).
To evaluate sample adequacy, the human β-globin gene was amplified using 1 μL gDNA, 6.25 μL 2x SYBR Green, 0.625 μL of each of 10 μM primer and 4 μL of deionized distilled water in a total volume of 12.5 μL. The assays were performed using MJ Research, Chromo 4 system (Reno, Nevada, USA). The PCR was conducted with an initial denaturation of 95 °C for 15 min, followed by 35 cycles of 95 °C for 20 sec, annealing temperature of 56 °C for 1 min, extension temperature of 72 °C for 1 min, a final cycle of 72 °C for 4 min. All samples that presented positive for β-globin were used to detect HPV and other sexually transmitted bacteria.

Tantengco O.A., Nakura Y., Yoshimura M., Nishiumi F., Llamas-Clark E.F, & Yanagihara I. (2022). Co-infection of human papillomavirus and other sexually transmitted bacteria in cervical cancer patients in the Philippines. Gynecologic Oncology Reports, 40, 100943.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!