The amplification of toxin genes from genomic DNA of strain KMU01 was performed with the specific primer sets designed by Abbas et al. [27 ] using Inclone™ Taq polymerase (Inclone Biotech, Daejeon, Korea) in a T-3000 Thermocycler (Biometra, Gottingen, Germany). The samples were preheated for 5 min at 95 °C and then amplified using 30 cycles of 1 min at 95 °C, 30 s at 57 °C, and 1 min at 72 °C. PCR products were migrated in 1.2% agarose gel stained with ethidium bromide and checked by ultraviolet light. Bacillus cereus KCCM 11341 was used as a positive control. The experiments were conducted at least three times.
T3000 thermocycler
Manufactured by Analytik Jena
Sourced in Germany, United States
The T3000 Thermocycler is a laboratory instrument designed for thermal cycling applications in molecular biology. Its core function is to precisely control and cycle the temperature of samples, enabling various temperature-dependent processes such as polymerase chain reaction (PCR) amplification. The T3000 Thermocycler provides accurate temperature regulation and uniform heating across multiple sample wells to ensure consistent and reliable results.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Rneasy plus mini kit, by Qiagen (4 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Dneasy tissue kit, by Qiagen (2 mentions)
Centrifugal filter unit, by Merck Group (2 mentions)
Go script reagent, by Promega (2 mentions)
Dneasy blood tissue kit, by Qiagen (2 mentions)
Qiaxcel capillary electrophoresis, by Qiagen (2 mentions)
Platinum taq polymerase, by Thermo Fisher Scientific (2 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (2 mentions)
Sybr green supermix, by Bio-Rad (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Nucleospin rna protein kit, by Macherey-Nagel (2 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (2 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (2 mentions)
Purelink genomic dna extraction kit, by Thermo Fisher Scientific (2 mentions)
Wizard genomic dna purification kit, by Promega (2 mentions)
Abi 3500dx genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Gotaq polymerase, by Promega (1 mentions)
65 protocols using t3000 thermocycler
1
Amplification of Toxin Genes from Strain KMU01
2
Bacillus subtilis Identification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To differentiate B. subtilis from other Bacillus species, two genes, aroE and pycA, were selected based on MLST. B. subtilis-specific primer sets were designed (Table 2 ). Genomic DNA of Bacillus species was extracted using a DNeasy tissue kit (Qiagen, Germany). Amplification of the aroE and pycA genes was performed using the primer sets aroE-F/-R and pycA-F/-R, respectively. The PCR conditions were as follows: an initial denaturation step at 95°C for 5 min, followed by 30 cycles consisting of 95°C for 30 sec, 60°C for 30 sec, and 72°C for 30 sec, then a post-extension step at 72°C for 5 min, and finally holding at 16°C in a T3000 Thermocycler (Biometra, Germany). Amplified PCR products were migrated on a 1.5% agarose gel.
3
CRISPR1 Locus Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR1 locus amplification was performed in a T3000 thermocycler (Biometra) using CRISPR1-PCR-F and CRISPR1-PCR-R primers targeting flanking regions of the CRISPR1 locus as previously described (18 (link), 19 (link), 29 (link)). Briefly, 0.5 μM each primer, 0.2 mM deoxynucleoside triphosphate (dNTP), 2 mM MgCl2, 0.02 U/μL GoTaq polymerase (Promega), 1× PCR buffer, and a small GBS colony were mixed in a total volume of 25 μL. The PCR mixtures were heated to 94°C for 5 min, followed by 40 cycles of a denaturation step at 94°C for 30 s, an annealing step at 55°C for 30 s, and an elongation step at 72°C for 1 min, ending with a final extension step at 72°C for 7 min. PCR amplification was verified by electrophoretic migration in a 1% agarose gel, and then the PCR products were purified using centrifugal filter units (Millipore Corporation) in accordance with the manufacturer’s recommendations.
CRISPR1 locus sequencing from purified PCR products was then performed by the Sanger sequencing technique on an ABI 3500 Dx genetic analyzer (Applied Biosystems, Thermo Fisher Scientific), using CRISPR1-SEQ-F and CRISPR1-SEQ-R internal sequencing primers and BigDyeTerminator mix v3.1 (Applied Biosystems) as previously described (19 (link)).
CRISPR1 locus sequencing from purified PCR products was then performed by the Sanger sequencing technique on an ABI 3500 Dx genetic analyzer (Applied Biosystems, Thermo Fisher Scientific), using CRISPR1-SEQ-F and CRISPR1-SEQ-R internal sequencing primers and BigDyeTerminator mix v3.1 (Applied Biosystems) as previously described (19 (link)).
4
Gene Expression Profiling of Adipogenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
The following genes, ie, PPARγ, C/EBP-α, Adiponectin, ACC-β, FASn, SREBF, were suggested to be involved in adipogenesis and lipogenesis. Total mRNA was isolated using RiboEx reagent (GeneAll, Seoul, Korea), and mRNA concentration was quantified using NanoDrop 2000c spectrophotometer (Thermo Scientific, Waltham, MA, USA). Reverse transcription of total mRNA (1 µg) was done using GoScript reagent (Promega, Fitchburg, WI, USA). Gene expression study was carried out using gene-specific primers (Table 1 ). Gene amplification was done using PCR, GoTaq (Promega, Fitchburg, WI, USA) or real-time PCR, SsoFastTM EvaGreen® Supermix (Biorad, Hercules, California, USA). PCR and qPCR were performed using T3000 Thermocycler (Biometra, Göttingen, German) and Mini Opticon MJ MiniTM (Biorad, Hercules, California, USA), respectively.
The following genes, ie, PPARγ, C/EBP-α, Adiponectin, ACC-β, FASn, SREBF, were suggested to be involved in adipogenesis and lipogenesis. Total mRNA was isolated using RiboEx reagent (GeneAll, Seoul, Korea), and mRNA concentration was quantified using NanoDrop 2000c spectrophotometer (Thermo Scientific, Waltham, MA, USA). Reverse transcription of total mRNA (1 µg) was done using GoScript reagent (Promega, Fitchburg, WI, USA). Gene expression study was carried out using gene-specific primers (
Gene-specific primers
| Gene | Sequence |
|---|---|
| PPAR-γ | Forward: 5ʹ-TTCTCAAGGGTGCCAGTTTC-3ʹ |
| C/EBP-α | Forward: 5ʹ-GAGTCGGCCGACTTCTACCAG-3ʹ |
| Adiponectin | Forward: 5ʹ-GTTGCAAGCTCTCCTGTTCC-3ʹ |
| ACC-β | Forward: 5ʹ-CTTGATGCCGCCGTAAATC-3ʹ |
| FASn | Forward: 5ʹ-AGGATCTCTCCAAGTTCGACG-3ʹ |
| SREBF | Forward: 5ʹ-GACACCTGCACCCTTGTCCC-3ʹ |
5
Filaggrin Mutation Screening Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All patients were screened for the nine most common filaggrin mutations found in the Irish population (R501X, 2282del4, R2447X, S1010X, G1139X, R3419X, 3702delG, Y209X and S3247X), by either restriction digest or direct Sanger sequencing, Full details including primers sequences and PCR cycling conditions are listed in
Table 1 . PCR amplification reactions were performed on a Biometra T3000 Thermocycler (Göttingen, Germany).
6
Cloning of Transcription Factor ORFs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full length mouse C/EBPα, PPARγ1, PPARγ2 and KLF5 open reading frames (ORFs) were amplified from day 3 wound-RNA using reverse transcriptase and polymerase chain reaction according to standard DNA cloning protocols. PCR was performed on a T3000-Thermocycler (Biometra, Göttingen, Germany). Primers were 5’-GCA TGG TAC CAC CAT GGA GTC GGC CGA CTT CT-3’ (forward) and 5’-GCT AGG TGA CCC GCG CAG TTG CCC ATG GCC T-3’ (reverse) for C/EBPα; 5’-GCT AGC TAG CCA CCA TGG TTG ACA CAG AGA TGC CA-3’ (forward) and 5’-CGA TGG TGA CCA TAC AAG TCC TTG TAG ATC TCC T-3’ (reverse) for PPARγ1; 5’-GCT AGC TAG CCA CCA TGG GTG AAA CTC TGG GAG-3’ (forward) and 5’-CGA TGG TGA CCA TAC AAG TCC TTG TAG ATC TCC T-3’ (reverse) for PPARγ2. CEBPα, PPARγ1 and PPARγ2 amplicons were digested and cloned into pcDNA3-1-myc-HisC (Invitrogen, Karlsruhe, Germany) via Kpn/BstEII restriction sites to generate the CEBPα-, PPARγ1- and PPARγ2- Myc-6Histidine-tagged expression plasmids: pcCEBPα-, pcPPARγ1- and pcPPARγ2-Myc6HisC, respectively. For murine KLF5, the following primers 5’-GCATGCTAGCCACCATGCCCACGCGGGTGCTGA-3’ (forward) and 5’- CGATGGATCCGTTCTGGTGGCGCTTCATGT-3’ (reverse) were used. KLF5 amplicons were digested and cloned into of pCMV Akt1 FLAG-N3 [49 (link)] via NheI/BamHI restriction sites to generate the KLF5-Flag-tagged expression plasmid pCMVKLF5.
7
PCR Detection of S. moniliformis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two PCRs for the detection of S. moniliformis based on the 16S rRNA gene were performed with minor modifications [12 (link), 31 ]. Freshly cultured colonies were suspended in 180 μl sterile distilled water. After incubation for 15 min at 100°C the lysates were centrifuged at 12.000 x g for 10 min to remove cell debris. One microliter of the supernatant was used for subsequent PCR analysis according to Kimura et al. (primers S5: 5’-CATACTCGGAATAAGATGG-3’ and AS2: 5’-GCTTAGCTCCTCTTTGTAC-3’; PCR program as follows: x1 (95°C, 180 sec), x35 (95°C, 20 sec, 53°C, 60 sec, 72°C, 60 sec), x1 (72°C, 420 sec)) [12 (link)] and Nicklas (primers SbmF: 5’-GAGAGAGCTTTGCATCCT-3’ and SbmR: 5’-GTAACTTCAGGTGCAACT-3’; x1 (94°C, 240 sec), x35 (94°C, 60 sec; 50°C, 60 sec; 72°C, 60 sec), x1 (72°C, 420 sec)) (cited in [31 ]), respectively. All PCRs were carried out in a T3000 Thermocycler (Biometra, Göttingen, Germany). Amplicons of 269 and 1222 bp, respectively, were detected by electrophoresis in 1.5% agarose gel containing ethidium bromide (1 mg/ml), visualised in an UV transilluminator and photographed. DNA extracted from S. moniliformis strain NCTC 11941 served as positive control in all runs.
8
Determining T-cell Receptor Diversity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from Tregs and Tconvs using the DNeasy Blood & Tissue Kit (Qiagen). Quantification of TSDR demethylation by real-time PCR was performed by Epiontis (Berlin, Germany) as previously described [22] (link).
The TCR diversity of ex vivo unexpanded and in vitro expanded Tregs was analyzed using a next generation sequencing protocol (NGS) [23] (link), [24] (link). Briefly, RNA was isolated using the RNeasy plus kit (Qiagen) and cDNA was synthesized with SuperScript III Reverse Transcriptase and oligo-dT primers (Invitrogen) [25] (link). Linear amplification of the cDNA was performed on a T3000 thermocycler (Biometra). The amplified samples were analyzed by NGS on the Genome Sequencer FLX (Roche) using the titanium platform. After TCR sequencing, the Vß-, Jß variants and the CDR3 were identified.
The TCR diversity of ex vivo unexpanded and in vitro expanded Tregs was analyzed using a next generation sequencing protocol (NGS) [23] (link), [24] (link). Briefly, RNA was isolated using the RNeasy plus kit (Qiagen) and cDNA was synthesized with SuperScript III Reverse Transcriptase and oligo-dT primers (Invitrogen) [25] (link). Linear amplification of the cDNA was performed on a T3000 thermocycler (Biometra). The amplified samples were analyzed by NGS on the Genome Sequencer FLX (Roche) using the titanium platform. After TCR sequencing, the Vß-, Jß variants and the CDR3 were identified.
9
Quantifying MCT1 and MCT4 Expression in AML
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was retrospectively obtained from BM samples, M0-M5 (n=58); M6/M7 (n=13), collected at time of diagnosis of AML patients with available material (Hemato-oncology laboratory (LHO), IPO Lisboa).
cDNA was synthesized from 1μg RNA and reversely transcribed by SuperScript II Reverse Transcriptase (18080-44, Invitrogen), according to the manufacturer’s protocol, in a T3000 thermocycler (Biometra).
Quantitative Real-Time PCR (qRT-PCR) was performed using Power SYBR Green PCR Master Mix (4367659, AB), according to manufacturer’s protocol. Primers for MCT1 (For: 5’GCTGGGCAGTGGTAATTGGA3’; Rev: 5’CAGTAATTGATTTGGGAAATGCAT3’), MCT4 (For: 5’CACAAGTTCTCCAGTGCCATTG3’; Rev: 5’CGCATCCAGGAGTTTGCCTC3’) and housekeeping gene – 18S (For: 5’GCCCTATCAACTTTCGATGGT3’; Rev: 5’CCGGAATCGAACCCTGATT3’) were used. Real-time PCR was carried out in an ABI Prism® 7900HT Sequence Detection System (Applied Biosystems).
For this experiment, cDNA obtained from an RNA pool of six BM samples from hematological disease-free individuals was used as a control.
cDNA was synthesized from 1μg RNA and reversely transcribed by SuperScript II Reverse Transcriptase (18080-44, Invitrogen), according to the manufacturer’s protocol, in a T3000 thermocycler (Biometra).
Quantitative Real-Time PCR (qRT-PCR) was performed using Power SYBR Green PCR Master Mix (4367659, AB), according to manufacturer’s protocol. Primers for MCT1 (For: 5’GCTGGGCAGTGGTAATTGGA3’; Rev: 5’CAGTAATTGATTTGGGAAATGCAT3’), MCT4 (For: 5’CACAAGTTCTCCAGTGCCATTG3’; Rev: 5’CGCATCCAGGAGTTTGCCTC3’) and housekeeping gene – 18S (For: 5’GCCCTATCAACTTTCGATGGT3’; Rev: 5’CCGGAATCGAACCCTGATT3’) were used. Real-time PCR was carried out in an ABI Prism® 7900HT Sequence Detection System (Applied Biosystems).
For this experiment, cDNA obtained from an RNA pool of six BM samples from hematological disease-free individuals was used as a control.
10
Multiplex Detection of DNA Viruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specimens were also tested for the presence of other DNA viruses, namely adenovirus (35 (link)) and PCV types 1 and 2 (36 ), using the conditions described above. The presence of RVA was also investigated using primers specific to VP7 and VP4 genes (30 (link), 37 (link)). A one-step RT-PCR reaction was used for RVA using a similar reaction mix to that described previously: 10 µl 5× Go Taq Flexi buffer®, 3 µl of 25 mM MgCl2, 8 µl 1.25 mM dNTP mix, 1 µl of each primer (50 pmol), 0.5 µl of 5 U/µl Taq Polymerase (Promega, USA), 0.2 µl of 10 U/µl AMV-RT (Promega, USA), and 3 µl of template.
All reactions were carried out on a Biometra T3000 thermocycler. Amplified products were visualised on a 1.5% agarose gel stained with ethidium bromide using a UV transilluminator.
All reactions were carried out on a Biometra T3000 thermocycler. Amplified products were visualised on a 1.5% agarose gel stained with ethidium bromide using a UV transilluminator.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!