Brca2

Manufactured by Thermo Fisher Scientific

Sourced in United States

The BRCA2 is a laboratory instrument used for the detection and analysis of the BRCA2 gene, which is associated with an increased risk of certain types of cancer. The core function of this product is to provide researchers and clinicians with a reliable and efficient tool for genetic testing and analysis, without interpretation or extrapolation on its intended use.

Automatically generated - may contain errors

Lab products found in correlation

Palb2, by Thermo Fisher Scientific (2 mentions) Taqman probe, by Thermo Fisher Scientific (2 mentions) Lightcycler480 2 sequence detection system, by Roche (1 mentions) Quantitect probe one step rt pcr kit, by Qiagen (1 mentions) Brca1, by Horizon Discovery (1 mentions) Rnaimax, by Thermo Fisher Scientific (1 mentions) Ion genestudio s5 system, by Thermo Fisher Scientific (1 mentions) Brca1, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

Ion AmpliSeq™ BRCA1 and BRCA2 Panel (8 citations)

4 protocols using brca2

TaqMan qPCR for USP22, BRCA2, PALB2

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

TaqMan probes for USP22, BRCA2, and PALB2 were obtained from Thermo Fisher with the respective product numbers: USP22 (4331182), BRCA2 (4351372), and PALB2 (4351372). QPCR methods used were described previously^{27 (link)}.

Nardi I.K., Stark J.M., Larsen A., Salgia R, & Raz D.J. (2019). USP22 interacts with PALB2 and promotes chemotherapy resistance via homologous recombination of DNA double strand breaks. Molecular cancer research : MCR, 18(3), 424-435.

+ Open protocol

+ Expand

Quantification of DNA Repair Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells in 96-well plates using the Qiagen FastLane Cell Probe Kit (QIAGEN, 216413), according to the manufacturer's instructions to a final volume of 40 μL per well, at the indicated timepoint after treatment. Gene expression was evaluated by qPCR using the ONE-step QuantiTect Probe RT-PCR Kit (Qiagen, catalog no./ID: 204445). For each reaction, 2 μL of RNA were used. Real-time qPCR reactions were performed on a Roche Lightcycler 480 II Sequence Detection System.
The following Taqman probes were obtained from Thermo Fisher Scientific: BRCA2 (Hs00609073_m1), IPO8 (Hs00914057_m1), RAD51B (Hs01568768_m1), RAD54L (Hs00941668.m1), Actin (Hs01060665.g1).
For data analysis, ΔC_t was calculated by subtracting average C_t of housekeeping genes from each C_t. An average ΔC_t for the control group was calculated and subtracted from ΔC_t to calculate negative ΔΔC_t. 2^−ΔΔC_t was used to calculate fold change.

Jamal K., Galbiati A., Armenia J., Illuzzi G., Hall J., Bentouati S., Barrell D., Ahdesmäki M., O'Connor M.J., Leo E, & Forment J.V. (2022). Drug–gene Interaction Screens Coupled to Tumor Data Analyses Identify the Most Clinically Relevant Cancer Vulnerabilities Driving Sensitivity to PARP Inhibition. Cancer Research Communications, 2(10), 1244-1254.

+ Open protocol

+ Expand

Targeted siRNA Knockdown in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

HT1080 or U2OS or H1299 cells were transfected with siRNAs (10 nM final concentration) using RNAiMAX (Invitrogen) according to the manufacturer's instructions. Medium was replaced 24 h after transfection. The sequences of the siRNAs are listed below:
non-targeting (NT) proprietary sequence of supplier (Qiagen),
BRCA2 (Thermo Scientific): GGGAAACACUCAGAUUAAAUU, UUUAAUCUGAGUGUUUCCCUU;
BRCA1 (Dharmacon): AAUGCCAAAGUAGCUAAUGUAUUUU, AAUACAUUAGCUACUUUGGCAUUUU;
CtIP (Dharmacon): GAGGUUAUAUUAAGGAAGA, GGAGCUACCUCUAGUAUCA, GAACAGAAUAGGACUGAGU, GCACGUUGCCCAAAGAUUC;
MRE11 (Dharmacon): GGAGGUACGUCGUUUCAGA, GGAAAUGAUACGUUUGUAA, CGAAAUGUCACUACUAAGA, GAAAGGCUCUAUCGAAUGU;
RPA (Dharmacon): AACUGGUUGACGAAAGUGGUGUU, CACCACUUUCGUCAACCAGUUUU;
POLQ (Ambion, Lifetechnologies): CCGCUUUUGGAGUCAGUAATT, UUACUGACUCCAAAAGCGGTA.

Ahrabi S., Sarkar S., Pfister S.X., Pirovano G., Higgins G.S., Porter A.C, & Humphrey T.C. (2016). A role for human homologous recombination factors in suppressing microhomology-mediated end joining. Nucleic Acids Research, 44(12), 5743-5757.

+ Open protocol

+ Expand

Comprehensive Genetic Profiling of HCPS

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNAs from patients were extracted from blood samples after signing informed consent forms using the NLM DNA extraction kit (Nuclear Laser Medicine) as previously described [11 (link),12 (link),13 (link)]. We designed two Ion Ampliseq On-Demand panels to explore, using NGS, the mutational status of the most frequently altered genes in HCPS. The panel includes BRCA1, BRCA2, ATM, PALB2, TP53, CHEK2, MLH1, MSH2, MSH6 and PMS2 (Thermo Fisher Scientific, Waltham, MA, USA) covering the full coding exons plus padding regions of the above-described genes. Libraries were constructed and purified on the Ion Chef Instrument according to the Ampliseq manufacturer’s instructions. Subsequently, libraries were sequenced by the Ion GeneStudio S5 System (Thermo Fisher Scientific, Waltham, MA, USA).

Paduano F., Colao E., Fabiani F., Rocca V., Dinatolo F., Dattola A., D’Antona L., Amato R., Trapasso F., Baudi F., Perrotti N, & Iuliano R. (2022). Germline Testing in a Cohort of Patients at High Risk of Hereditary Cancer Predisposition Syndromes: First Two-Year Results from South Italy. Genes, 13(7), 1286.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!