Bovine serum albumin (bsa)

Glass micro slides (Gold Seal) were washed by hand with Alconox detergent and warm water, then dried with nitrogen. Sample channels were constructed with Parafilm strips and a plasma-cleaned glass coverslip (Fisher Scientific). Channels were blocked with 10 mg/mL BSA (NEB) for 1 h and washed with imaging buffer (50 mM Tris-HCl, pH 8.3, 50 mM KCl, 1 mM MgCl₂, 1 mg/ml BSA, 8% glucose, and [±]-6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid [Trolox] at saturation). Trolox-containing imaging buffer was generally filtered (0.2 µm) before and after adjusting the pH to 8.3 with NaOH. For imaging, 0.01 volumes of “Gloxy” solution (10 mM Tris-HCl, pH 8.0, 50 mM NaCl, 200 µg/mL catalase, 100 mg/mL glucose oxidase) were added to the imaging buffer.

The same DNA input (10 ng) was used for both embryo and sperm samples. For quality control purposes, all samples were spiked in with a mixture of six synthetic DNA constructs harbouring MseI restriction sites at each end. One pair of constructs was designed for each methyl-sensitive restriction enzyme (HpaII, HinP1I and Aci1I) to be used in the fragment selection process. For each pair, one control DNA fragment was methylated in vitro using CpG methyltransferase M.SssI (New England Biolabs). The difference between the extents of cleavage obtained with each pair was used to calculate cleavage efficiency. Residual MseI sites within the fragments were measured after processing to determine the extent of genomic fragmentation.
Sample (in 30 μL of elution buffer) plus 0.5 μL of bovine serum albumin (New England Biolabs), 5 μL of 10× Buffer 4 (New England Biolabs) and 28 μL of DNAse/RNAse free water were divided into two equal fractions and fragmented using 10 U of MseI (New England Biolabs) as follows, 16 h at 37°C followed by 65°C for 20 min. The two fractions were combined and DNA was concentrated by ethanol precipitation following addition of 5 μg of linear acrylamide solution (Ambion) as carrier and 5 μL of sodium acetate buffer (3 M, pH 5.5, Ambion Inc.). The pellet was washed twice with 70% ethanol, air-dried and resuspended in 5 μL of DNAse/RNAse free water.

Nuclease assays (15 μl volume) were carried out with ³²P-labeled oligonucleotide-based DNA substrate blocked at all ends with streptavidin (1 nM molecules, oligonucleotides, 210: GTAAGTGCCGCGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCATGCATC and 211: GATGCATGAGGTGGAGTACGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCACCCGCACCGCGGCACTTAC)^{25 (link)}, in a buffer containing 25 mM Tris-acetate, pH 7.5, 1 mM dithiothreitol, 5 mM magnesium acetate, 1 mM manganese acetate, 1 mM ATP, 80 U/ml pyruvate kinase (Sigma), 1 mM phosphoenolpyruvate, 0.25 mg/ml bovine serum albumin (New England Biolabs). 30 nM streptavidin (Sigma), was added to the substrate containing the reaction mixture and incubated for 5 min at room temperature. Recombinant proteins were then added on ice and incubated for 30 min at 30 °C. Reactions were terminated and the DNA products were separated by denaturing gel electrophoresis and detected by autoradiography^{46 (link)} and the data were quantitated.

All quality-checked DNA extracts were screened by PCR amplification of the V4 region of the 16S rRNA gene before sequencing on an Illumina MiSeq. Each 25 μl reaction used 1X GoTaq reaction buffer (Promega, Madison, WI, USA), 0.3 μM each of primers 515F and 806R (Caporaso et al., 2011 (link); Invitrogen, Carlsbad, CA, USA), 1.25 units of GoTaq DNA polymerase (Promega, Madison, WI, USA), 300 ng/μl bovine serum albumin (New England BioLabs, Ipswich, MA, USA), 50 ng of template DNA, and nuclease-free water (Thomas Scientific, Swedesboro, NJ, USA). PCR reactions were run on a T-100 Thermal Cycler (BioRad, Hercules, CA, USA) for 3 min at 95 °C, 30 cycles of: 30 s at 95 °C, 30 s at 50 °C, and 60 s at 72 °C, followed by a single 5 min cycle at 72 °C. Bands were visualized using agarose gel electrophoresis. PCR reactions lacking the expected 350 bp product were re-cleaned using magnetic beads as described above and screened by PCR a second time.