Log In Sign up
The largest database of trusted experimental protocols

Mmlv kit

Manufactured by Evrogen
Visit Supplier
Sourced in China

The MMLV kit is a laboratory reagent used for the reverse transcription of RNA into complementary DNA (cDNA). It contains the Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV-RT) enzyme and the necessary buffers and reagents to perform this reaction. The kit is designed to facilitate the conversion of RNA into a DNA form that can be utilized in various downstream applications, such as gene expression analysis and cDNA library construction.

Automatically generated - may contain errors

Lab products found in correlation

Trizol kit, by Thermo Fisher Scientific (3 mentions) Qpcrmix hs sybr lowrox kit, by Evrogen (3 mentions) 7500 real time pcr machine, by Thermo Fisher Scientific (3 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Qpcrmix hs sybr, by Evrogen (1 mentions) Cfx96 amplifier, by Bio-Rad (1 mentions) Hydrochloric acid (hcl), by Merck Group (1 mentions) Formaldehyde, by Merck Group (1 mentions) Extractrna, by Evrogen (1 mentions) Cleanrna standard kit, by Evrogen (1 mentions) Potassium hexacyanoferrate 2 trihydrate, by Merck Group (1 mentions) Hematoxylin and eosin, by BioVitrum (1 mentions) Hs taq dna polymerase, by Evrogen (1 mentions) Sybr green 1 dye, by Evrogen (1 mentions) Bradford assay, by Thermo Fisher Scientific (1 mentions) Bovine serum albumin (bsa), by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

MMLV RT kit (130 citations) MMLV reverse transcription kit (16 citations) MMLV reverse transcriptase kit (5 citations) MMLV Reverse transcription PCR Kit with oligo(dT)15 (RT-PCR, (3 citations) MMLV RT reagent kit (2 citations)

6 protocols using mmlv kit

1

Quantification of mRNA and vDNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
To quantify mRNA level, a total RNA from 1 × 106 cells was isolated using Trizol reagent (Invitrogen). cDNA was synthetized using the MMLV kit from Evrogen (Russia), and qPCR was performed with primers indicated in Additional file 1: Table S1 using the qPCR Mix-HS SYBR from Evrogen (Russia) on a Biorad CFX96 amplifier (Biorad). The total and integrated vDNA were quantified 24 h.p.i., unless otherwise indicated, as previously described [56 (link)]. Post-integrational gap repair efficiency was measured by modified Alu-specific PCR as described in detail in [39 (link)].
Knyazhanskaya E., Anisenko A., Shadrina O., Kalinina A., Zatsepin T., Zalevsky A., Mazurov D, & Gottikh M. (2019). NHEJ pathway is involved in post-integrational DNA repair due to Ku70 binding to HIV-1 integrase. Retrovirology, 16, 30.
+ Open protocol
+ Expand
2

Magnetic Nanoparticles for Biomedical Applications

Check if the same lab product or an alternative is used in the 5 most similar protocols
Magnetic nanoparticles coated with glucuronic acid from Chemicell GmbH (Germany) specified as “50-nm fluidMAG-ARA”; hematoxylin and eosin from Biovitrum (Russia); potassium hexacyanoferrate (II) trihydrate, hydrochloric acid, and formaldehyde from Sigma-Aldrich (USA); K3-EDTA test tubes from Guangzhou Improve Medical Instruments (China); ExtractRNA, CleanRNA Standard kit, MMLV kit, HS Taq DNA Polymerase, and SYBR Green I dye from Evrogen (Russia) were used in the experiments. All other chemicals were of analytical grade.
Yaremenko A.V., Zelepukin I.V., Ivanov I.N., Melikov R.O., Pechnikova N.A., Dzhalilova D.S., Mirkasymov A.B., Bragina V.A., Nikitin M.P., Deyev S.M, & Nikitin P.I. (2022). Influence of magnetic nanoparticle biotransformation on contrasting efficiency and iron metabolism. Journal of Nanobiotechnology, 20, 535.
+ Open protocol
+ Expand
3

Diurnal Oscillation of nnluz Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
In experiments aimed to determine whether expression of nnluz gene oscillates during the day, we collected the third leave counting from apical bud from twenty seven 25-day-old transgenic glowing plants. The leaves were collected with three-hour intervals during 24 hours, leaves from three plants were collected at each time point. From each plant we collected leaves only once. All leaves were flash-freezed in liquid nitrogen and homogenized for RNA extraction with TRIzol kit (Thermo Fisher Scientific, USA). Synthesis of the first cDNA strand was carried out with MMLV kit (Evrogen, Russia). Quantitative PCR was performed with qPCRmix-HS SYBR+LowROX kit (Evrogen, Russia) on 7500 Real-Time PCR machine (Applied Biosystems, USA) with primers annealing at nnluz transcript: GGACCAGGAGTCCCAGGC and CTTGGCATTTTCGACAATCTTA with following program: 95°C - 1 min, then 40 cycles of (95°C - 15 sec, 60°C - 15 sec, 72°C - 15 sec).
Mitiouchkina T., Mishin A.S., Somermeyer L.G., Markina N.M., Chepurnyh T.V., Guglya E.B., Karataeva T.A., Palkina K.A., Shakhova E.S., Fakhranurova L.I., Chekova S.V., Tsarkova A.S., Golubev Y.V., Negrebetsky V.V., Dolgushin S.A., Shalaev P.V., Shlykov D., Melnik O.A., Shipunova V.O., Deyev S.M., Bubyrev A.I., Pushin A.S., Choob V.V., Dolgov S.V., Kondrashov F.A., Yampolsky I.V, & Sarkisyan K.S. (2020). Plants with genetically encoded autoluminescence. Nature biotechnology, 38(8), 944-946.
+ Open protocol
+ Expand
4

Diurnal Oscillation of nnluz Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
In experiments aimed to determine whether expression of nnluz gene oscillates during the day, we collected the third leave counting from apical bud from twenty seven 25-day-old transgenic glowing plants. The leaves were collected with three-hour intervals during 24 hours, leaves from three plants were collected at each time point. From each plant we collected leaves only once. All leaves were flash-freezed in liquid nitrogen and homogenized for RNA extraction with TRIzol kit (Thermo Fisher Scientific, USA). Synthesis of the first cDNA strand was carried out with MMLV kit (Evrogen, Russia). Quantitative PCR was performed with qPCRmix-HS SYBR+LowROX kit (Evrogen, Russia) on 7500 Real-Time PCR machine (Applied Biosystems, USA) with primers annealing at nnluz transcript: GGACCAGGAGTCCCAGGC and CTTGGCATTTTCGACAATCTTA with following program: 95°C - 1 min, then 40 cycles of (95°C - 15 sec, 60°C - 15 sec, 72°C - 15 sec).
Mitiouchkina T., Mishin A.S., Somermeyer L.G., Markina N.M., Chepurnyh T.V., Guglya E.B., Karataeva T.A., Palkina K.A., Shakhova E.S., Fakhranurova L.I., Chekova S.V., Tsarkova A.S., Golubev Y.V., Negrebetsky V.V., Dolgushin S.A., Shalaev P.V., Shlykov D., Melnik O.A., Shipunova V.O., Deyev S.M., Bubyrev A.I., Pushin A.S., Choob V.V., Dolgov S.V., Kondrashov F.A., Yampolsky I.V, & Sarkisyan K.S. (2020). Plants with genetically encoded autoluminescence. Nature biotechnology, 38(8), 944-946.
+ Open protocol
+ Expand
5

Quantifying Polyketide Synthase Gene Expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
To determine the expression level of target polyketide synthase genes, yeast biomass was flash frozen in liquid nitrogen and homogenised for RNA extraction with the TRIzol kit (Thermo Fisher Scientific, Waltham, MA, USA). Synthesis of the first cDNA strand was carried out with the MMLV kit (Evrogen, Moscow, Russia). RT-PCR was performed with a qPCRmix-HS SYBR + LowROX kit (Evrogen) on a 7500 real-time PCR machine (Applied Biosystems, Waltham, MA, USA) with primers annealing at hsPKS, gcPKS, cgPKS, nnHispS, and actin 1 genes [39 (link)] as housekeeping control (primers are listed in Supplementary Table S1) using the following program: 95 °C for 1 min, followed by 40 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s. The PCR product size was confirmed by melting curve determination. In total, three technical replicates for assayed polyketide synthases genes and actin 1 control for each strain were analysed.
Palkina K.A., Balakireva A.V., Belozerova O.A., Chepurnykh T.V., Markina N.M., Kovalchuk S.I., Tsarkova A.S., Mishin A.S., Yampolsky I.V, & Sarkisyan K.S. (2023). Domain Truncation in Hispidin Synthase Orthologs from Non-Bioluminescent Fungi Does Not Lead to Hispidin Biosynthesis. International Journal of Molecular Sciences, 24(2), 1317.
+ Open protocol
+ Expand
6

Ku70-Ku80 Heterodimer Expression Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
For the construction of heterodimer Ku expression, vector pET15b_His6_Ku70_(- XhoI restriction sites into the vector pET15b-Ku70, obtained at the previous step. The primer Ku80-N-BamHI introduced the Shine-Dalgarno sequence GAGG, the intercistronic sequence AATT, and a stop codon at the 3'-end of the Ku70 gene after the ligation of the PCR product into the vector for the optimal translation efficiency of the Ku80 gene located with -1nt shift relative to the stop codon of the Ku70 gene [50] (link).
To obtain the sequence coding the human HEXIM1 protein, total RNA from HEK 293T cells was extracted by TRIzol Reagent (Thermo Fisher Scientific, USA) according to the manufacturer's protocol and cDNA was synthesized using the MMLV kit (Evrogen, Russia).
Then, the HEXIM1 coding sequence (corresponded to NP_006451. Protein concentrations were measured by Bradford assay (Thermo Fisher Scientific, USA) using BSA (Thermo Fisher Scientific, USA) as a protein standard.
Shadrina O., Garanina I., Korolev S., Zatsepin T., Van Assche J., Daouad F., Wallet C., Rohr O, & Gottikh M. (2020). Analysis of RNA binding properties of human Ku protein reveals its interactions with 7SK snRNA and protein components of 7SK snRNP complex. Biochimie, 171-172.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!