Abi 7500 fast real time pcr instrument

Total RNA was extracted using miRNeasy mini kits (Qiagen, Hilden, Germany). For cDNA synthesis, total RNA was transcribed using ReverTra Ace qPCR RT master mix with gDNA remover (Toyobo, Osaka, Japan). Real-time qPCR for cyclooxygenase (COX)-2 mRNA detection was performed using Thunderbird SYBR qPCR mix (Toyobo), an ABI 7500 Fast real-time PCR instrument (Applied Biosystems, Foster City, CA, USA), and COX-2-specific primers [(5′ → 3′) Fw: CTGGCGCTCAGCCATACAG; Rv: CCGGGTACAATCGCACTTATACT; Thermo Fisher Scientific, Waltham, MA, USA] according to manufacturer instructions. The expression of β-actin was measured using specific primers [(5′ → 3′) Fw: CTCTTCCAGCCTTCCTTCCT; Rv: AGCACTGTGTTGGCGTACAG; Thermo Fisher Scientific] as an internal control.

We quantified App and β-actin mRNA levels by QPCR analysis. Total RNA was extracted using the RNeasy mini kit (Qiagen), and first-strand cDNA synthesis was carried out using the QuantiTect reverse transcription kit (Qiagen) in accordance with the manufacturer’s instructions. We diluted cDNA 1:1 in H₂O and carried out QPCR for all genes of interest using cDNA-specific TaqMan primer/probe sets (TaqMan Gene Expression Assays, Applied Biosystems) on an ABI 7500 Fast real-time PCR instrument (Applied Biosystems). Each 20-μl reaction mixture contained 2 μl of cDNA with 1 μl of TaqMan Gene Expression Assay reagent, 10 μl of TaqMan Fast Universal PCR Master Mix (Applied Biosystems), and 7 μl of H₂O. Thermocycler conditions consisted of 95 °C for 15 s, followed by 40 cycles of 95 °C for 1 s and 60 °C for 20 s. Mouse TaqMan probe/primer sets were as follows: App (number Mm01344172_m1); and β-actin (number Mm00607939_s1; used as an internal reference control) (Applied Biosystems). Samples that were not subjected to reverse transcription were run in parallel as negative controls to rule out genomic DNA contamination, and a “no template control” was also included for each primer set. The cycle threshold number (C_T) method (68 (link)) was used to determine relative amounts of initial target cDNA in each sample. Results were expressed relative to vehicle-treated APP/PS1/E2 mice.

Total nucleic acid was extracted from 200 µL of CSF using the Roche MagNA Pure 96 instrument and Viral NA small volume kit (Roche). Samples were tested in duplicate using a multiplex, real-time PCR assay targeting hpd (H. influenzae), ctrA (N. meningitidis), and lytA (S. pneumoniae) genes (HNS assay) [14 (link)] and an ABI 7500 Fast real-time PCR instrument (Applied Biosystems). Positivity was assigned based on target amplification in both duplicates (C_t, <40). Real-time PCR, detecting the human RNase P (RNP) gene [15 (link)], was performed to confirm sample integrity and the absence of inhibitors—standard practice for all clinical specimens processed at the RRL. PCR results for clinical samples that test negative for the targeted pathogen and with C_t values ≥36 for RNP are routinely reported as inconclusive because they may be falsely negative. The RRL is accredited by the South African National Accreditation System, and the workflow and assays are conducted using standardized procedures with systems in place to detect and minimize errors and the risk of DNA contamination.

Total RNA was isolated from skin biopsy using the TRIzol RNA reagent (Invitrogen, Carlsbad). Reverse transcription was performed using a PrimeScript® RT reagent kit (Takara Bio Inc., Tokyo). The cDNA samples were used as templates for qPCR amplification. PCR was performed on ABI 7500 Fast Real-time PCR instrument (Applied Biosystems, Foster City) using the SYBR® Premix EX Taq system (Takara Bio Inc., Tokyo) according to the manufacturer's instructions. The primers were designed by Primer 5.0 software, and their specificity was confirmed by BLAST queries. The PCR reaction conditions are listed in Table 2. All PCR reactions were performed in triplicate. The relative quantification of the expression of target genes was evaluated using the comparative CT method as described previously [13 (link)].

The expression level of P. armeniaca CBF and DAM5-6 genes was determined by means of real-time PCR (ABI 7500 Fast Real-Time PCR instrument, Applied Biosystems) using PB20.17-05 qPCRBIO SyGreen Blue Mix (Nucleotest Bio Ltd., Budapest, Hungary). The relative fold change (FC) values were calculated with the ΔΔCt method (Bookout and Mangelsdorf, 2003 (link)). The quantitative PCR primers were designed in this study from specific regions of the newly identified ParCBF1, ParDAM5, and ParDAM6 genes (Table 2).

Total RNA was extracted at 24 h post-infection and purified using the RNeasy Mini Kit (Qiagen). The one-step quantitative real-time RT-PCR was carried out using an ABI 7500 Fast real-time PCR instrument (Applied Biosystems) using SuperScript III Platinum SYBR Green One-Step qRT-PCR kit (Transgen) with the following conditions: 50 °C for 5 min, 95 °C for 30 seconds, followed by 35 cycles of 95 °C for 5 s, 60 °C for 30 s. The mRNA of IAV M2, CVB3 VP1, RSV M2, and GAPDH were amplified with specific primers (Oligonucleotides used were shown in Table 1) [15 (link), 16 (link)]. The samples were normalized by subtracting the CT values of GAPDH and the relative amounts of viral RNA were calculated.Table 1

Oligonucleotides used in this study

Oligonucleotide	Sequence
5’ M2 (influenza)	GACCRATCCTGTCACCTCTGAC
3’ M2 (influenza)	GGGCATTYTGGACAAAKCGTCTACG
5’β-actin (Monkey)	TGACGGGGTCACCCACACTGTGCCCATCTA
3’ β-actin (Monkey)	CTAGAAGCATTTGCGGTGGACGATG
5’ VP1 (CVB3)	TGCTCCGCAGTTAGGATTAGC
3’ VP1 (CVB3)	ACATGGTGCGAAGAGTCTATTGAG
5’ M2 (RSV)	GTTGCCATGAGCAAACTCCT
3’ M2 (RSV)	ACGTCTGCTGGCAATCTTTT
5’ N (CoV-229E)	CGCAAGAATTCAGAACCAGAG
3’ N (CoV-229E)	GGCAGTCAGGTTCTTCAACAA
5’ GAPDH (Homo)	GGTGGTCTCCTCTGACTTCAACA
3’ GAPDH (Homo)	GTTGCTGTAGCCAAATTCGTTGT