Total rna rapid extraction kit

Ten seeds per replication were used for RNA extraction in each sample. Total RNA was isolated separately from each sample using a Total RNA Rapid Extraction Kit (BioTeke Corporation, Wuxi, China). Three biological replications were performed. Ribosomal RNA (rRNA) in the samples was depleted using the Ribo-Zero™ Magnetic Kit (Epicentre, Madison, WI, USA) according to the manufacturer’s instructions. The cDNA libraries were generated and sequenced by Shanghai Hanyu Biotechnology Company Ltd. (Shanghai, China) using an Illumina sequencing NovaSeq platform.

The mRNA levels of STRA6, FBLIM1, KIAA0895, and CARHSP1 (Supplementary Table S1 for primer sequences) were detected by real-time quantitative reverse transcriptase PCR (qRT-PCR). Total RNA was extracted using the total RNA Rapid Extraction Kit (BIOTEKE, RP1201) according to the manufacturer’s instructions. The SYBR Green ® Realtime PCR Master Mix (#QPK-201, Toyobo Co, Ltd, Osaka, Japan) was used for qRT-PCR assays. The data were analyzed on an Applied Biosystems 7900 Real-Time PCR System. The target genes were normalized to the mean β-actin expression.

The EEF1A1, BPY2, ABCA12, ECE1, TAF1L, C20orf203, NIPSNAP1, and RAD9A mRNA levels (see Table 1 for primer sequences) were detected by real-time quantitative reverse transcriptase PCR (q-PCR). Total RNA was extracted using the total RNA Rapid Extraction Kit (BIOTEKE, RP1201) according to the manufacturer's instructions. The SYBR Green® Realtime PCR Master Mix (#QPK-201, Toyobo Co, Ltd, Osaka, Japan) was used for quantitative reverse transcriptase PCR assays. The data were analyzed with an Applied Biosystems 7900 Real Time PCR System. Target genes were normalized to the mean β-actin expression.

Total RNA rapid extraction kit (BioTeke, RP1201) was employed to extract total RNA from CRC cells or tissues. First strand of cDNA was synthesized using M‐MLV reverse transcriptase (Takara, Tokyo, Japan). Real‐time PCR analyses were performed by using SYBR Green (BioTeke, Beijing, China) and Taq HS Perfect Mix (Takara, Tokyo, Japan) on Exicycler™ 96 (Bioneer). The 2^−∆∆Ct method was applied to quantify fold change. The primer sequences were listed as follows: hsa‐miR‐140‐3p: RT‐primer: 5’‐GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCCGTGG‐3′, forward: 5′‐TACCACAGGGTAGAACCACGG‐3′, reverse: 5′‐GCAGGGTCCGAGGTATTC‐3′; U6: RT‐primer: 5′‐GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAAAATATGG‐3′, forward: 5′‐GCTTCGGCAGCACATATACT‐3′, reverse: 5′‐GTGCAGGGTCCGAGGTATTC‐3′; BCL2: forward: 5′‐CTGGGAGAACAGGGTACGATAA‐3′, reverse: 5′‐CTGGGAGAACAGGGTACGATAA‐3′; BCL9: forward: 5′‐CCAATCAGGGTAAACAGGG‐3′, reverse: 5′‐ AGGAGTCGGCGGAAATAC‐3′; GAPDH: forward: 5′‐GACCTGACCTGCCGTCTAG‐3′, reverse: 5′‐AGGAGTGGGTGTCGCTGT‐3′.

Ten-day-old whole seedlings were used for determination of the MYB37 transcript levels in the wild-type Col-0 and MYB37-overexpressing plants. Leaves of 3 to 4-week-old seedlings were sampled for ABA induction of MYB37 and expression of a subset of ABA-responsive genes. Total RNA was isolated from 10-day-old plants or leaves of 3 to 4-week-old seedlings using Total RNA Rapid Extraction Kit (BioTeke, China), treated with RNase-free DNaseΙ (NEB) at 37 °C for 1 h to degrade genomic DNA, and purified by using RNA Purification Kit (BioTeke, China). Two micrograms of total RNA were subjected to first-strand cDNA synthesis using Roche Transcriptor First Strand cDNA Synthesis Kit and an oligo (dT18) primer. The primers of various ABA-responsive genes used for real-time PCR are listed in the Supplemental Table 2. Analysis was performed using the BioRad Real-Time System CFX96TM C1000 Thermal Cycler (Singapore). Amplification of ACTIN2/8 genes was used as an internal control. The cDNA was amplified using SYBR Premix Ex Taq (TaKaRa) with a DNA Engine Opticon 2 thermal cycler in a 10 μL volume. All experiments were repeated at least three times along with three biologically independent repetitions.

Total RNA was extracted from 2-week-old plants with a Total RNA Rapid Extraction Kit (BioTeke, RP1202, China), treated with RNase-free DNase I (NEB, M0303S, USA) to degrade genomic DNA, and then purified using an RNA Purification Kit (BioTeke, RP1802, China) according to the manufacturer’s instructions. A 5 μg aliquot of RNA was used for first-strand cDNA synthesis using the Transcriptor cDNA synthesis Kit (Roche, 4 897 030 001, Germany). The primers of a series of ABA-responsive genes used for qRT-PCR are listed in Supplementary Table S1. Analysis was performed using the Real-Time System CFX96™ C1000 Thermal Cycler (Bio-Rad, USA). All experiments were repeated at least three times along with three independent repetitions of the biological experiments. ACTIN2/8 genes were used as internal controls.

The rosette leaves from 4-week-old plants were used for determination of the transcription levels of CRK5, CRK5^K372E, CRK4, CRK19 and CRK20 in the wild-type Col-0 and their corresponding transgenic lines. Seedlings grown 4 days after stratification were sampled for detection of the expression level of ABA-responsive genes. Total RNA was extracted and purified using the total RNA Rapid Extraction Kit (BioTeke, Beijing, China) and RNA Purification Kit (BioTeke, Beijing, China), respectively, according to the manufacturer’s instructions. Single-strand cDNA was synthesized using 2 µg of total RNA with the Roche Transcriptor First Strand cDNA Synthesis Kit (Roche, Mannheim, Germany). Real-time PCR was performed using the CFX96TM Real-Time System of C1000TM Thermal Cycler and SYBR Premix Ex Taq (TaKaRa, Dalian, China) with the program as follows: 5min at 94 °C and then 30 cycles of 5s at 94 °C, 30s at 60 °C. ACTIN2/8 gene was used as an internal control. All the real-time PCR assays were performed in triplicate and means of the three biological repeats were calculated to represent gene expression level. Primers for real-time PCR are listed in Supplementary Table S1. TAIL-PCR was performed essentially as described previously (Liu et al., 1995 (link); Mei et al., 2014 (link)). Random primers and the specific left border primer of pCAMBIA-1300-221 are listed in Supplementary Table S1.