Lipofectamine 8000

The SDPR mammalian expression plasmid was purchased from miaolingbio (Wuhan, China). Cells in logarithmic growth stage were collected and seeded into 6-well plates one day before transfection to make the cell density reach 70-80% at transfection. 2 ug plasmid was transfected into cells using Lipofectamine 8000 (Invitrogen) according to the manufacturer's recommendations.

Three haplotypes of the ACBD5 gene (HAP1, HAP2. HAP3) and their 50 bp upstream and 50 bp downstream were generated via PCR and cloned into the pGL3 enhancer vector; these fragments included HAP1 (100 bp), HAP2 (105 bp), HAP3 (110 bp). The Xhol and HindIII enzyme sites were selected as the insertion sites of PCR products. Duck embryo fibroblasts cell were plated at a density of 1 × 10⁵ per well in 48‐well plates 1 day before transfection and were cultured under adherent conditions in high‐glucose DMEM (HyClone) +10% FBS (fetal bovine serum, Gibco). Cells were transfected with 220 ng (per well) of serial plasmids containing different segments of the three haplotypes sequence and 20 ng (per well) of the pRL‐ TK Renilla Luciferase plasmid using Lipofectamine 8000 (Invitrogen). Luciferase activities were determined by using the Dual‐Luciferase Reporter Assay System (Promega), according to the manufacturer's instructions. Luciferase bioluminescence measurements were performed with a Veritas Microplate Luminometer (Promega). All of the experiments were conducted in triplicate, and the firefly luciferase activity was normalized to the Renilla luciferase activity of each sample.

Small hairpin RIP2 (shRIP2) plasmid (Table S1), the 3′UTR of IRF2 and its mutation (Table S2), and gga-miR-455-5p mimics and inhibitor (Table S3) were synthesized by GenePharma (Shanghai, China). The Lipofectamine™ 8000 reagent (Invitrogen, Carlsbad, CA, USA) was used for the cell transfection according to the manufacturer’s instructions. After transfection with shRIP2 for 48 h, cells were treated with or without 0.1 mL 1 × 10⁸ cfu of APEC O78 for 24 h, and collected for total RNA for the miRNA-seq. Cells were transfected with the gga-miR-455-5p mimics or inhibitor for 48 h. Then, cells were collected for RT-qPCR or challenged with 0.1 mL 1 × 10⁸ cfu of APEC O78 for 48 h for further study.

Gene-specific siRNAs and nonsense control were provided by Tsingke (Beijing, China). PDAC cells were transfected with siRNA using Lipofectamine 8000 (Invitrogen, California, USA). After the knockdown efficiency was confirmed by quantitative RT-PCR (qRT-PCR) and western blot, the cells were used for subsequent experiment. The overexpression plasmids were provided by RiboBio (Guangzhou, China). The plasmids were transfected into the cells with Lipofectamine 8000 as recommended by the manufacturer. The sequences of primers and siRNAs used were listed in S1 Table.

The target plasmids include as follows: sh-vector, shPMEPA1-A, shPMEPA1-B, oe-vector, and oePMEPA1. According to its manufacturer, the above plasmids with the packaging plasmid psAX2 and envelope plasmid VSVG were transfected into 293T cells by lipofectamine 8000 (Invitrogen) instructions. The shPMEPA1-A sequences were as follows: Sense: CCGGGAGTTTGTTCAGATCATCATCCTCGAGGATGATGATCTGAACAAACTCTTTTTG; anti-sense: AATTCAAAAAGAGTTTGTTCAGATCATCATCCTCGAGGATGATGATCTGAACAAACTC. The shPMEPA1-B sequences were as follows: Sense: CCGGGTCCCTATGAATTGTACGTTTCTCGAGAAACGTACAATTCATAGGGACTTTTTG; anti-sense: AATTCAAAAAGTCCCTATGAATTGTACGTTTCTCGAGAAACGTACAATTCATAGGGAC. After 48 h, the virus was directly added to cells in a 6-well plate (or immediately frozen in -80°C freezer for future use) for 24 h, and after 48 h culture, we collected the cell protein to test the infection efficiency.

The short hairpin RNA (shRNA) for silencing ZFAS1 (shZFAS1#1, shZFAS1#2) and the negative control (shNC) were obtained from Genepharma (Shanghai, China). The pcDNA-ZFAS1, pcDNA-IMP2, shIMP2#1, shIMP2#2 and blank vector (NC) were purchased by Genechem (Shanghai, China). All of the shRNA nucleotide sequences were listed in Additional file 1: Tables S10–S11. Plasmid extraction kit was purchased from Sangon Biotech (Shanghai, China). The cells were cultured on a small dish to a density of 60–70%, and then transfected with Lipofectamine 8000 (Invitrogen, USA) according to the manufacturer's instructions. Cells were collected 48 h after transfection and used for further experiments.