The miRNA mimics (miR-23b mimic), inhibitors (miR-23b inhibitor) and negative controls of miR-23b were purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China) and transfected into C2C12 at final concentrations of 50 nM per well in a 24-well plate with Entranster-R transfection reagent (Engreen, Beijing, China) following the manufacturer's instructions. The component was mixed in serum-free DMEM, and then the transfection was conducted in complete DMEM and refreshed 6 h subsequent to transfection. The plasmids were transfected into cells using Lipofectamine 2000 Reagent (Invitrogen; Thermo Fisher Scientific, Inc.) as described previously (14 (link)).
Mir 23b mimic
Manufactured by GenePharma
Sourced in China
The MiR-23b mimic is a laboratory reagent used to modulate the expression of the miR-23b microRNA. It can be used to study the biological functions of miR-23b in various experimental models.
Automatically generated - may contain errors
Lab products found in correlation
Mir 23b inhibitor, by GenePharma (5 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Entranster r transfection reagent, by Engreen Biosystem (1 mentions)
Si nc, by GenePharma (1 mentions)
Lipofectamine 3000 regent, by Thermo Fisher Scientific (1 mentions)
Pex 2 plasmid, by GenePharma (1 mentions)
Scramble mirna, by GenePharma (1 mentions)
Dulbecco s modified eagle medium, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Ab128908, by Abcam (1 mentions)
Sa00001 2, by Proteintech (1 mentions)
Mirna mimic control, by GenePharma (1 mentions)
Mirna inhibitor control, by GenePharma (1 mentions)
Pmirglo luciferase vector, by Promega (1 mentions)
Hek293t cells, by GenePharma (1 mentions)
Dual luciferase assay system, by Promega (1 mentions)
Hiperfect transfection reagent, by Qiagen (1 mentions)
Nc oligonucleotides, by GenePharma (1 mentions)
Top flash reporter gene including β catenin binding sites, by Merck Group (1 mentions)
8 protocols using mir 23b mimic
1
Transfection of miR-23b mimic and inhibitor in C2C12 cells
2
Regulation of PDCD4 by miR-23b in ATDC5 cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Scramble miRNA, miR-23b mimic, miR-23b inhibitor, negative control of miR-23b inhibitor, programmed cell death 4 (PDCD4)-specific small interfering RNA (si-PDCD4), and its negative control (siNC) were all purchased from GenePharma Co. (Shanghai, China). The full-length PDCD4 was ligated into a pEX-2 plasmid (GenePharma Co.), and the recombined plasmid was referred to as pEX-PDCD4. Lipofectamine 3000 regent (Invitrogen) was utilized for cell transfection in line with the protocol of the manufacturer. The empty pEX-2 plasmid was also transfected into ATDC5 cells, termed as pEX group. Stable transfection was selected by G418 (0.5 mg/ml; Sigma-Aldrich). Cells transiently transfected with miRNAs were harvested at 72 hr post-transfection.
3
miR-23b Regulates Macrophage Inflammation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To investigate the role of miR-23b expression in the macrophage differentiated from THP-1 cells, miR-23b mimic was obtained from GenePharma Co. Ltd (Shanghai, China) and was transfected into the above THP-1 derived macrophage. After 6 h, oxLDL (50 μg/ml) was introduced to stimulate the THP-1 derived macrophage, and the mRNA expression and protein level of inflammatory factors (TNF-α and IL-1β) and chemotactic factor (MCP-1) were determined 24 h later.
4
Rat Aortic Smooth Muscle Cell Culture and Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rat aortic smooth muscle cell (RA-SMC) line was purchased from ScienCell Research Laboratories and cultured (at 37°C, 5% CO2) in Dulbecco’s modified Eagle medium (GIBCO, LifeTechnologies, USA), containing 10% FBS (GIBCO, LifeTechnologies, USA) with 1% of penicillin-streptomycin. Cells were treated with different concentrations of platelet-derived growth factor-BB (PDGF-BB) for different lengths of time. XR007793 siRNA, miR-23b mimic, and miR-23b inhibitor and were purchased from Genepharma Company (Shanghai, China). Cells at 70% confluence were transfected with siRNA or miRNA mimics/inhibitor by Lipofectamine 2000 reagent (Life Technologies, USA). Antibodies against FOXO4 antibody (ab128908, 1: 5000), SMα-actin antibody (ab5694, 1: 5000), SM22 antibody (ab10135, 1: 5000) were purchased from Abcam (Cambridge, MA, USA), secondary antibody (SA00001-2, 1: 2000) was purchased from Proteintech (Wuhan, China)
5
HOTAIR Knockdown in HeLa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For HOTAIR knockdown, HeLa cells were transfected with 50 nM of siRNAs targetting HOTAIR (GAACGGGAGUACAGAGAGAUU) and siGFP (CUACAACAGCCACAACGUCdTdT) were used as scrambled control [25 (link)]. Full length of HOTAIR, miR-23b mimic, miRNA mimic control, 2′-O-methyl (2′-O-Me)-modified miR-23b inhibitor, and miRNA inhibitor control were chemically synthesized by Shanghai GenePharma Company (Shanghai, China).
6
Validating miR-23b Interaction with TLR4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The binding sites of miR-23b and TLR4 were predicted via the Starbase (http://starbase.sysu.edu.cn ). The complementary binding sequence and mutation sequence of miR-23b and TLR4 were amplified and cloned into pmiR-Glo luciferase vector (Promega, Madison, WI, USA) to construct wild-type plasmid (TLR4-WT) and mutant plasmid (TLR4-MUT), and construct TLR-NC at the same time. According to the instructions of LipofectamineTM 3000 (Invitrogen, Carlsbad, CA, USA), the constructed plasmids were cotransfected with mimic NC and miR-23b mimic (GenePharma) into HEK293T cells (Shanghai Institute of cell biochemistry, Chinese Academy of Sciences). Luciferase activity was detected 48 hours later.
7
Investigating miR-23b-mediated regulation of ST7L and AKT signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MiR-23b mimics, miR-23b inhibitor, ST7L siRNA and NC oligonucleotides were obtained from GenePharma. ST7L expression plasmids and flag-tagged AKT plasmids were obtained from Biogot Technology (Nanjing, China). To generate reporter construct, one fragment of ST7L 3′-UTR including two putative miR-23b complementary sites was fused to a modified pcDNA3.1 vector containing a luciferase gene, which was inserted upstream of multiple cloning sites. Reporter plasmids with mutant sites were prepared by Mutagenesis Kit (Stratagene, La Jolla, CA, USA). TOP/FLASH reporter gene including β-catenin binding sites was obtained from Millipore (Billerica, MA, USA). Oligonucleotides were transfected by Hiperfect transfection reagent (Qiagen, Valencia, CA, USA) and plasmids were transfected by Lipofectamine 3000 (Invitrogen) into cells. Luciferase activity assay was conducted using Dual Luciferase Assay System (Promega, Madison, WI, USA).
8
Molecular Regulation of Cellular Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small interfering RNA (siRNA) for GAS5, MITF, TFE3, TFEB, Raptor, DGKE, and its negative controls, as well as miR-23a mimics, miR-23b mimics, mimic NC, miR-23a inhibitor, miR-23b inhibitor, and inhibitor NC, were supplied by GenePharma (Shanghai, China). Overexpression plasmids for GAS5, MITF, TFE3, TFEB, and DGKE were supplied by GeneCreate Biological Engineering Co. (Wuhan, China), and the plasmid pcDNA-3.1 was used as a negative control. All transfections were carried out using Lipofectamine 3000 transfection reagent according to the manufacturer’s protocol (Thermo Fisher, Waltham, MA, USA, L3000075).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!